plurigestion sa

Perspectives of farmers and tourists on agricultural abandonment in east Lesvos, Greece.

by
Perspectives of farmers and tourists on agricultural abandonment in east Lesvos, Greece.

Multi-stakeholder perceptions of panorama modifications are more and more acknowledged as important inputs to discussions on future panorama developments, significantly when addressing the way forward for European rural areas experiencing agricultural abandonment.

This analysis presents a case exploration of abandonment of olive plantations in east Lesvos, Greece. We carried out two units of semi-structured interviews to narrate an exploration on native farmers’ capacity and willingness to keep up the plantations, to the outcomes of a panorama choice survey undertaken with vacationers. Three farmer varieties are recognized following a cluster evaluation based mostly on attributes of particular person capacity and willingness to farm. Farmers belonging to the prevalent kind revealed low capacity and willingness and count on to additional extensify their farms.

The remaining two farmer varieties have greater willingness; they’re motivated by cultural causes, extra incessantly expressing a want to keep up their land underneath household possession, and partake in social cooperative initiatives selling practices valorizing the olive plantations. We define how these varieties work together with regional drivers of change, and partly additionally contribute to persistence of abandonment by way of constrained capacity to farm.

Abandonment doesn’t align with present panorama preferences of vacationers, who favor cultivated landscapes, components of traditionality inside constructed infrastructure and undertake nature-based actions. We focus on how excessive willingness to farm related to skilled and pluri-active types of farming could nevertheless present alternatives to keep up the cultivated panorama and synergize with (agri-)tourism demand. Our findings are corresponding to these of different European research, contributing to discussions on the way forward for its rural landscapes.

Perspectives of farmers and tourists on agricultural abandonment in east Lesvos, Greece.
Views of farmers and vacationers on agricultural abandonment in east Lesvos, Greece.

Immunophenotypic characterization, multi-lineage differentiation and growing older of zebrafish coronary heart and liver tissue-derived mesenchymal stem cells as a novel strategy in stem cell-based remedy.

Mesenchymal stem cells (MSCs) are a very good mannequin for preclinical and scientific investigations, and various sources of MSCs are topic to intensive experiments. On this examine, mesenchymal stem cells (MSCs) have been remoted from coronary heart and liver tissue of Zebrafish (Danio rerio). The flow-cytometry in addition to RT-PCR have been used to investigate the expression of a panel of cell floor markers CD44, CD90, CD31 and CD34.

VALI Medium
450 500 ml
EUR 265.00

Paritaprevir(ABT-450)
20-abx184297
  • EUR 1247.00
  • EUR 913.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

iFluor™ 450 maleimide
1057 1 mg
EUR 219.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

AKT1 (Ab-450) Antibody
21502-100ul 100ul
EUR 252.00

AKT1 (Ab-450) Antibody
21502-50ul 50ul
EUR 187.00

AKT1 (Ab-450) Antibody
CSB-PA969941-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against AKT1 (Ab-450). Recognizes AKT1 (Ab-450) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

AKT1 (Ab-450) Antibody
CSB-PA969941-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against AKT1 (Ab-450). Recognizes AKT1 (Ab-450) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

anti-AKT1 (Ab-450)
LF-PA20679 100 ul
EUR 334.00
Description: Rabbit polyclonal to AKT1

Nhe I unit: 450
YRNHE1 1 vial Ask for price

Polyclonal TLR1 Antibody (aa400-450)
APR02824G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR1 (aa400-450). This antibody is tested and proven to work in the following applications:

Polyclonal SNX4 Antibody (aa438-450)
AMM07924G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SNX4 (aa438-450). This antibody is tested and proven to work in the following applications:

Polyclonal CYP1B1 Antibody (aa400-450)
APG02857G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CYP1B1 (aa400-450). This antibody is tested and proven to work in the following applications:

Polyclonal PACSIN2 Antibody (aa400-450)
APR17733G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PACSIN2 (aa400-450). This antibody is tested and proven to work in the following applications:

AKT1 (Ab-450) Conjugated Antibody
C21502 100ul
EUR 397.00

mFluor™ Violet 450 acid
1140 5 mg
EUR 219.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

mFluor™ Violet 450 SE
1150 1 mg
EUR 219.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

mFluor™ 450-VAD-FMK
13475 25 Tests
EUR 132.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Filter for Accuris Microplate Reader
MR9600-450 1 PC
EUR 201.30
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Recombinant (CHO cells) Hepatitis B Surface Antigen adr subtype (HBsAg)
RP-450 20 ug
EUR 164.00

GFP-Rac1 Expression Vector Set
STA-450 1 kit
EUR 1616.00
Description: GFP-Rac1 Expression Vector Set contains 3 vectors: Rac wild type, T17N dominant negative mutant, and Q61L constitutively active mutant. Each vector also contains a GFP reporter sequence.

Polyclonal CYP24 / CYP24A1 Antibody (aa400-450)
APG02862G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CYP24 / CYP24A1 (aa400-450). This antibody is tested and proven to work in the following applications:

mFluor™ Violet 450-streptavidin conjugate
16930 100 ug
EUR 132.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Polyclonal OLFM4 / Olfactomedin 4 Antibody (aa400-450)
APR02466G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OLFM4 / Olfactomedin 4 (aa400-450). This antibody is tested and proven to work in the following applications:

Polyclonal TUBB / Beta Tubulin Antibody (aa401-450)
APR13866G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB / Beta Tubulin (aa401-450). This antibody is tested and proven to work in the following applications:

Annexin V-mFluor™ Violet 450 conjugate
20080 100 tests
EUR 219.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Recombinant Salmonella envZ Protein (aa 1-450)
VAng-Wyb0428-inquire inquire Ask for price
Description: Salmonella typhi Osmolarity sensor protein EnvZ, recombinant protein.

Polyclonal HTR2C / 5-HT2C Receptor Antibody (aa400-450)
APR07860G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HTR2C / 5-HT2C Receptor (aa400-450). This antibody is tested and proven to work in the following applications:

Monoclonal TUBB3 / Tubulin Beta 3 Antibody (aa436-450)
APR13878G 0.05mg
EUR 484.00
Description: A Monoclonal antibody against Human TUBB3 / Tubulin Beta 3 (aa436-450). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC

Recombinant Shigella Sonnei wzyE Protein (aa 1-450)
VAng-0304Lsx-inquire inquire Ask for price
Description: Shigella Sonnei (strain Ss046) Putative ECA polymerase, recombinant protein.

Human Her2 Protein (Thr 23-Ile 450) [Fc]
VAng-1710Lsx-1mg 1 mg
EUR 6649.00
Description: Human Her2, Fc tag, is expressed in human 293 cells. (Uniprot ID: AAA75493)

Human Her2 Protein (Thr 23-Ile 450) [Fc]
VAng-1710Lsx-25g 25 µg
EUR 765.00
Description: Human Her2, Fc tag, is expressed in human 293 cells. (Uniprot ID: AAA75493)

Human LAG3 Protein (Leu 23-Leu 450) [His]
VAng-1870Lsx-100g 100 µg
EUR 985.00
Description: Human LAG3 protein, His tag, expressed in human 293 cells. (Uniprot ID: P18627)

Human LAG3 Protein (Leu 23-Leu 450) [His]
VAng-1870Lsx-1mg 1 mg
EUR 6649.00
Description: Human LAG3 protein, His tag, expressed in human 293 cells. (Uniprot ID: P18627)

Recombinant Clostridium Perfringens CPE1497 Protein (aa 1-450)
VAng-Lsx00378-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Perfringens UPF0210 protein CPE1497, recombinant protein.

Recombinant Clostridium Perfringens CPE1497 Protein (aa 1-450)
VAng-Lsx00378-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Perfringens UPF0210 protein CPE1497, recombinant protein.

Recombinant Clostridium Perfringens CPE1497 Protein (aa 1-450)
VAng-Lsx00378-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Perfringens UPF0210 protein CPE1497, recombinant protein.

Recombinant Clostridium Perfringens CPF_1748 Protein (aa 1-450)
VAng-Lsx00411-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Perfringens (strain ATCC 13124 / NCTC 8237 / Type A) UPF0210 protein CPF_1748, recombinant protein.

Recombinant Clostridium Perfringens CPF_1748 Protein (aa 1-450)
VAng-Lsx00411-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Perfringens (strain ATCC 13124 / NCTC 8237 / Type A) UPF0210 protein CPF_1748, recombinant protein.

Recombinant Clostridium Perfringens CPF_1748 Protein (aa 1-450)
VAng-Lsx00411-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Perfringens (strain ATCC 13124 / NCTC 8237 / Type A) UPF0210 protein CPF_1748, recombinant protein.

Recombinant Clostridium Perfringens pgi Protein (aa 1-450)
VAng-Lsx00638-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Perfringens Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Perfringens pgi Protein (aa 1-450)
VAng-Lsx00638-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Perfringens Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Perfringens pgi Protein (aa 1-450)
VAng-Lsx00638-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Perfringens Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Symbiosum gdh Protein (aa 2-450)
VAng-Lsx01507-1mgEcoli 1 mg (E. coli)
EUR 5058.00
Description: Clostridium Symbiosum NAD-specific glutamate dehydrogenase, recombinant protein.

Recombinant Clostridium Symbiosum gdh Protein (aa 2-450)
VAng-Lsx01507-500gEcoli 500 µg (E. coli)
EUR 3572.00
Description: Clostridium Symbiosum NAD-specific glutamate dehydrogenase, recombinant protein.

Recombinant Clostridium Symbiosum gdh Protein (aa 2-450)
VAng-Lsx01507-50gEcoli 50 µg (E. coli)
EUR 2425.00
Description: Clostridium Symbiosum NAD-specific glutamate dehydrogenase, recombinant protein.

Recombinant Pasteurella Multocida PM0878 Protein (aa 1-450)
VAng-Cr7120-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Pasteurella Multocida (strain Pm70) Deoxyguanosinetriphosphate triphosphohydrolase-like protein (PM0878), recombinant protein.

Recombinant Pasteurella Multocida PM0878 Protein (aa 1-450)
VAng-Cr7120-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Pasteurella Multocida (strain Pm70) Deoxyguanosinetriphosphate triphosphohydrolase-like protein (PM0878), recombinant protein.

Recombinant Pasteurella Multocida PM0878 Protein (aa 1-450)
VAng-Cr7120-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Pasteurella Multocida (strain Pm70) Deoxyguanosinetriphosphate triphosphohydrolase-like protein (PM0878), recombinant protein.

Recombinant Streptococcus Agalactiae glmM Protein (aa 1-450)
VAng-Cr7495-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Streptococcus Agalactiae serotype Ia Phosphoglucosamine mutase (glmM), recombinant protein.

Recombinant Streptococcus Agalactiae glmM Protein (aa 1-450)
VAng-Cr7495-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Streptococcus Agalactiae serotype Ia Phosphoglucosamine mutase (glmM), recombinant protein.

Recombinant Streptococcus Agalactiae glmM Protein (aa 1-450)
VAng-Cr7495-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Streptococcus Agalactiae serotype Ia Phosphoglucosamine mutase (glmM), recombinant protein.

Recombinant Streptococcus Thermophilus gor Protein (aa 1-450)
VAng-Cr8420-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Streptococcus Thermophilus Glutathione reductase (gor), recombinant protein.

Recombinant Streptococcus Thermophilus gor Protein (aa 1-450)
VAng-Cr8420-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Streptococcus Thermophilus Glutathione reductase (gor), recombinant protein.

Recombinant Streptococcus Thermophilus gor Protein (aa 1-450)
VAng-Cr8420-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Streptococcus Thermophilus Glutathione reductase (gor), recombinant protein.

Recombinant Clostridium Novyi pgi Protein (aa 1-450)
VAng-Lsx00068-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Novyi (strain NT) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Novyi pgi Protein (aa 1-450)
VAng-Lsx00068-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Novyi (strain NT) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Novyi pgi Protein (aa 1-450)
VAng-Lsx00068-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Novyi (strain NT) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Mouse AMH Protein (aa 450-552) (Yeast)
VAng-3013Lsx-1mg 1 mg
EUR 4807.00
Description: Recombinant Mouse AMH protein was expressed in yeast (Uniprot ID: P27106)

Recombinant Mouse AMH Protein (aa 450-552) (Yeast)
VAng-3013Lsx-200g 200 µg
EUR 1920.00
Description: Recombinant Mouse AMH protein was expressed in yeast (Uniprot ID: P27106)

Recombinant Mouse AMH Protein (aa 450-552) (Yeast)
VAng-3013Lsx-500g 500 µg
EUR 3129.00
Description: Recombinant Mouse AMH protein was expressed in yeast (Uniprot ID: P27106)

Recombinant Escherichia coli creD Protein (aa 1-450)
VAng-Lsx02251-inquire inquire Ask for price
Description: Escherichia coli (strain K12) Inner membrane protein CreD, recombinant protein.

Recombinant Escherichia coli envZ Protein (aa 1-450)
VAng-Lsx02364-inquire inquire Ask for price
Description: Escherichia coli (strain K12) Osmolarity sensor protein EnvZ, recombinant protein.

Recombinant Escherichia coli rseP Protein (aa 1-450)
VAng-Lsx02612-inquire inquire Ask for price
Description: Escherichia coli (strain K12) Regulator of sigma E protease, recombinant protein.

Recombinant Mycobacterium Tuberculosis aroA Protein (aa 1-450)
VAng-Yyj0406-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Mycobacterium Tuberculosis 3-phosphoshikimate 1-carboxyvinyltransferase (aroA), recombinant protein.

Recombinant Mycobacterium Tuberculosis mbtI Protein (aa 1-450)
VAng-Yyj0512-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Mycobacterium Tuberculosis Isochorismate synthase/isochorismate-pyruvate lyase mbtI (mbtI), recombinant protein.

Recombinant Mycobacterium Paratuberculosis mbtI Protein (aa 1-450)
VAng-Yyj0959-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Mycobacterium Paratuberculosis Isochorismate synthase/isochorismate-pyruvate lyase mbtI (mbtI), recombinant protein.

Recombinant Treponema Pallidum TP_0600 Protein (aa 1-450)
VAng-Cr1387-inquire inquire Ask for price
Description: Treponema Pallidum (strain Nichols) putative zinc metalloprotease TP_0600 (TP_0600), recombinant protein.

Recombinant Leptospira Biflexa pgi protein (aa 1-450)
VAng-Wyb0139-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Leptospira Biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Leptospira Biflexa pgi protein (aa 1-450)
VAng-Wyb0139-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Leptospira Biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Leptospira Biflexa pgi protein (aa 1-450)
VAng-Wyb0139-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Leptospira Biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Mycoplasma Pneumoniae ffh Protein (aa 1-450)
VAng-Lsx04718-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Mycoplasma Pneumoniae (strain ATCC 29342 / M129) Signal recognition particle protein, recombinant protein.

Recombinant Mycoplasma Pneumoniae ffh Protein (aa 1-450)
VAng-Lsx04718-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Mycoplasma Pneumoniae (strain ATCC 29342 / M129) Signal recognition particle protein, recombinant protein.

Recombinant Mycoplasma Pneumoniae ffh Protein (aa 1-450)
VAng-Lsx04718-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Mycoplasma Pneumoniae (strain ATCC 29342 / M129) Signal recognition particle protein, recombinant protein.

Recombinant Candida Albicans PUS1 Protein (aa 1-450)
VAng-Lsx05844-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) tRNA pseudouridine synthase 1, recombinant protein.

Recombinant Candida Albicans PUS1 Protein (aa 1-450)
VAng-Lsx05844-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) tRNA pseudouridine synthase 1, recombinant protein.

Recombinant Candida Albicans PUS1 Protein (aa 1-450)
VAng-Lsx05844-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) tRNA pseudouridine synthase 1, recombinant protein.

Recombinant Candida Albicans SAH1 Protein (aa 1-450)
VAng-Lsx05911-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Adenosylhomocysteinase, recombinant protein.

Recombinant Candida Albicans SAH1 Protein (aa 1-450)
VAng-Lsx05911-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Adenosylhomocysteinase, recombinant protein.

Recombinant Candida Albicans SAH1 Protein (aa 1-450)
VAng-Lsx05911-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Candida Albicans (strain SC5314 / ATCC MYA-2876) Adenosylhomocysteinase, recombinant protein.

Recombinant Mycoplasma Capricolum dnaA Protein (aa 1-450)
VAng-Lsx06178-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Mycoplasma Capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154) Chromosomal replication initiator protein DnaA, recombinant protein.

Recombinant Mycoplasma Capricolum dnaA Protein (aa 1-450)
VAng-Lsx06178-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Mycoplasma Capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154) Chromosomal replication initiator protein DnaA, recombinant protein.

Recombinant Mycoplasma Capricolum dnaA Protein (aa 1-450)
VAng-Lsx06178-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Mycoplasma Capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154) Chromosomal replication initiator protein DnaA, recombinant protein.

Recombinant Shigella Boydii wzyE Protein (aa 1-450)
VAng-Lsx09446-inquire inquire Ask for price
Description: Shigella Boydii serotype 4 (strain Sb227) Putative ECA polymerase, recombinant protein.

Recombinant Clostridium Difficile murC Protein (aa 1-450)
VAng-Lsx9238-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Difficile (strain 630) UDP-N-acetylmuramate--L-alanine ligase, recombinant protein.

Recombinant Clostridium Difficile murC Protein (aa 1-450)
VAng-Lsx9238-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Difficile (strain 630) UDP-N-acetylmuramate--L-alanine ligase, recombinant protein.

Recombinant Clostridium Difficile murC Protein (aa 1-450)
VAng-Lsx9238-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Difficile (strain 630) UDP-N-acetylmuramate--L-alanine ligase, recombinant protein.

Recombinant Bordetella Avium mnmE Protein (aa 1-450)
VAng-Lsx4162-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Bordetella Avium tRNA modification GTPase MnmE, recombinant protein.

Recombinant Bordetella Avium mnmE Protein (aa 1-450)
VAng-Lsx4162-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Bordetella Avium tRNA modification GTPase MnmE, recombinant protein.

Recombinant Bordetella Avium mnmE Protein (aa 1-450)
VAng-Lsx4162-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Bordetella Avium tRNA modification GTPase MnmE, recombinant protein.

Recombinant Bordetella Parapertussis mnmE Protein (aa 1-450)
VAng-Lsx4585-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Bordetella Parapertussis tRNA modification GTPase MnmE, recombinant protein.

Recombinant Bordetella Parapertussis mnmE Protein (aa 1-450)
VAng-Lsx4585-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Bordetella Parapertussis tRNA modification GTPase MnmE, recombinant protein.

Recombinant Bordetella Parapertussis mnmE Protein (aa 1-450)
VAng-Lsx4585-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Bordetella Parapertussis tRNA modification GTPase MnmE, recombinant protein.

Recombinant Helicobacter Pylori mnmE Protein (aa 1-450)
VAng-Lsx3295-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Helicobacter Pylori tRNA modification GTPase MnmE, recombinant protein.

Recombinant Helicobacter Pylori mnmE Protein (aa 1-450)
VAng-Lsx3295-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Helicobacter Pylori tRNA modification GTPase MnmE, recombinant protein.

Recombinant Helicobacter Pylori mnmE Protein (aa 1-450)
VAng-Lsx3295-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Helicobacter Pylori tRNA modification GTPase MnmE, recombinant protein.

Recombinant Helicobacter Pylori mqo Protein (aa 1-450)
VAng-Lsx3309-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Helicobacter Pylori Probable malate:quinone oxidoreductase, recombinant protein.

Recombinant Helicobacter Pylori mqo Protein (aa 1-450)
VAng-Lsx3309-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Helicobacter Pylori Probable malate:quinone oxidoreductase, recombinant protein.

Recombinant Helicobacter Pylori mqo Protein (aa 1-450)
VAng-Lsx3309-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Helicobacter Pylori Probable malate:quinone oxidoreductase, recombinant protein.

Recombinant Clostridium Acetobutylicum pgi Protein (aa 1-450)
VAng-Lsx7733-1mgEcoli 1 mg (E. coli)
EUR 5303.00
Description: Clostridium Acetobutylicum Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Acetobutylicum pgi Protein (aa 1-450)
VAng-Lsx7733-500gEcoli 500 µg (E. coli)
EUR 3583.00
Description: Clostridium Acetobutylicum Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Clostridium Acetobutylicum pgi Protein (aa 1-450)
VAng-Lsx7733-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Clostridium Acetobutylicum Glucose-6-phosphate isomerase, recombinant protein.

Recombinant Shigella Dysenteriae wzyE Protein (aa 1-450)
VAng-Lsx07570-inquire inquire Ask for price
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Putative ECA polymerase, recombinant protein.

Recombinant Shigella Flexneri envZ Protein (aa 1-450)
VAng-Lsx07730-inquire inquire Ask for price
Description: Shigella Flexneri Osmolarity sensor protein EnvZ, recombinant protein.

Recombinant Streptococcus Pneumoniae glmM Protein (aa 1-450)
VAng-Ly1119-50gEcoli 50 µg (E. coli)
EUR 2437.00
Description: Streptococcus Pneumoniae Phosphoglucosamine mutase, recombinant protein.

Recombinant Mycobacterium Vanbaalenii mshA Protein (aa 1-450)
VAng-Yyj5250-1mgEcoli 1 mg (E. coli)
EUR 5054.00
Description: Mycobacterium Vanbaalenii (strain DSM 7251 / PYR-1) D-inositol 3-phosphate glycosyltransferase (mshA), recombinant protein.

Recombinant Mycobacterium Vanbaalenii mshA Protein (aa 1-450)
VAng-Yyj5250-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Mycobacterium Vanbaalenii (strain DSM 7251 / PYR-1) D-inositol 3-phosphate glycosyltransferase (mshA), recombinant protein.

Recombinant Mycobacterium Vanbaalenii mshA Protein (aa 1-450)
VAng-Yyj5250-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Mycobacterium Vanbaalenii (strain DSM 7251 / PYR-1) D-inositol 3-phosphate glycosyltransferase (mshA), recombinant protein.

Recombinant Schizosaccharomyces Pombe SPBC409.19c Protein (aa 1-450)
VAng-Yyj6525-1mgEcoli 1 mg (E. coli)
EUR 5384.00
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Metaxin-like protein C409.19c (SPBC409.19c), recombinant protein.

Recombinant Schizosaccharomyces Pombe SPBC409.19c Protein (aa 1-450)
VAng-Yyj6525-500gEcoli 500 µg (E. coli)
EUR 3569.00
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Metaxin-like protein C409.19c (SPBC409.19c), recombinant protein.

Recombinant Schizosaccharomyces Pombe SPBC409.19c Protein (aa 1-450)
VAng-Yyj6525-50gEcoli 50 µg (E. coli)
EUR 2443.00
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Metaxin-like protein C409.19c (SPBC409.19c), recombinant protein.

Anti-ERBB2-VC-[14C]MMAE ADC
ADC-W-450 1mg Ask for price
Description: This ADC product is comprised of an anti-ERBB2 monoclonal antibody conjugated via a VC linker to [14C]MMAE

Human Anti-Anophels gambiae salivary protein gsG6 IgG ELISA kit, 96 tests, Quantitative
970-450-G6G 1 Kit
EUR 834.00

Mouse Anti-Respiratory syncytial virus (RSV) IgM ELISA kit, 2x96 tests, semi-quantitative
510-450-MRM 1 kit
EUR 712.00

Mouse Anti-Chikungunya virus E1 (CHIKV-E1) IgM ELISA kit, 96 tests, Quantitative
530-450-CEM 1 kit
EUR 834.00

Anti-Hu CD62P Purified
11-450-C025 0.025 mg
EUR 104.00

Anti-Hu CD62P Purified
11-450-C100 0.1 mg
EUR 167.00

1 G RHALBUMIN
62-450-RF 1 g/pk
EUR 97.00
Description: Media Catalog; Cell Culture Reagents

Mouse Anti-C4 binding protein A Polyclonal Antibody
CTA-450-100ug 100ug Ask for price
Description: Mouse anti-C4 binding protein A polyclonal antibody for WB.

Mouse Anti-C4 binding protein A Polyclonal Antibody
CTA-450-1mg 1mg Ask for price
Description: Mouse anti-C4 binding protein A polyclonal antibody for WB.

Carboxyl Polystyrene Particles
CPX1-450-10 10 mL
EUR 320.00
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Carboxyl Polystyrene Particles
CPX1-450-100 100 mL
EUR 2202.00
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

  1. Within the following, alizarin pink, oil red-O and toluidine blue staining have been carried out to judge the multi-lineage differentiation of zebrafish coronary heart and liver tissue-derived MSCs. Subsequently, the gene and protein expression of Oct4, Sox2 and Nanog as pluri

    -potent markers have been analyzed by RT-PCR and western blotting, respectively.

As well as, MTT assay was used for cell proliferation potential and inhabitants doubling time (PDT) evaluation. Additionally, the growing older of cells was investigated by β-galactosidase exercise assay. The outcomes confirmed that, like different MSCs, zebrafish coronary heart and liver tissue-derived MSCs have been constructive for mesenchymal, adverse for hematopoietic markers and expressed pluripotent markers Oct4, Sox2 and Nanog. Furthermore, these cells have been differentiated to osteocyte, adipocyte, and chondrocyte lineages following directed differentiation. It was discovered that PDT of zebrafish coronary heart and liver tissue-derived MSCs have been 50.67 and 46.61 h, respectively.

These cells had considerably extra speedy progress on day 4. Our outcomes present that zebrafish coronary heart and liver tissue-derived MSCs exhibited typical MSC traits together with fibroblast morphology, multi-lineage differentiation capability, pluriefficiency potential and expression of a typical set of basic MSC floor markers.

Safety and Activity of Metronomic Temozolomide in Second-Line Treatment of Advanced Neuroendocrine Neoplasms.

by
Safety and Activity of Metronomic Temozolomide in Second-Line Treatment of Advanced Neuroendocrine Neoplasms.

Platinum-based chemotherapy is the mainstay of front-line therapy of sufferers affected by pluri-metastatic intermediate/excessive grade NeuroEndocrine Neoplasms (NENs). Nevertheless, there aren’t any commonplace second-line remedies at illness development.

Earlier scientific experiences have evidenced that temozolomide (TMZ), an oral analog of dacarbazine, is lively in opposition to NENs at commonplace doses of 150 to 200 mg/mq per day on days 1 to five of a 28-day cycle, even when a major treatment-related toxicity is reported.

METHODS

Metastatic NENs sufferers had been handled on the ENETS (European NeuroEndocrine Tumor Society) heart of excellence of Naples (Italy), from 2014 to 2017 with a second-line various metronomic schedule of TMZ, 75 mg/m2per os “one week on/one week off”. Toxicity was graded with NCI-CTC standards v4.0; goal responses with RECIST v1.1 and efficiency standing (PS) in accordance with ECOG.

Twenty-six consecutive sufferers had been handled. Median age was 65.5 years. The predominant main organs had been pancreas and lung. Grading was G2 in 11 sufferers, G3 in 15. Greater than half of sufferers had a PS 2 (15 vs. 11 with PS 1). The median time-on-temozolomide remedy was 12.2 months (95% CI: 11.4-19.6). No G3/G4 toxicities had been registered.

Full response was obtained in 1 affected person, partial response in 4, steady illness in 19 (illness management price: 92.3%), and progressive illness in 2. The median total survival from TMZ begin was 28.Three months. PS improved in 73% of sufferers.Metronomic TMZ is an acceptable therapy for G2 and G3 NENs significantly in PS 2 sufferers. Potential and bigger trials are wanted to verify these outcomes.

Safety and Activity of Metronomic Temozolomide in Second-Line Treatment of Advanced Neuroendocrine Neoplasms.
Security and Exercise of Metronomic Temozolomide in Second-Line Remedy of Superior Neuroendocrine Neoplasms.

Would ivermectin for malaria management be useful in onchocerciasis-endemic areas?

There may be accumulating proof supporting using ivermectin as a malaria management software. Latest findings from the repeat ivermectin mass drug administrations for management of malaria trial demonstrated a diminished incidence of malaria in villages which obtained repeated ivermectin mass drug administration (MDA; six doses) in comparison with those that had just one spherical of ivermectin.

EEF1A2 Antibody
ABD9493 100 ug
EUR 438.00

EEF1A2 siRNA
20-abx914976
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF1A2 siRNA
20-abx914977
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF1A2 antibody
70R-3046 50 ug
EUR 467.00
Description: Rabbit polyclonal EEF1A2 antibody raised against the middle region of EEF1A2

EEF1A2 Antibody
45965-100ul 100ul
EUR 252.00

EEF1A2 Antibody
45965-50ul 50ul
EUR 187.00

EEF1A2 antibody
70R-17001 50 ul
EUR 435.00
Description: Rabbit polyclonal EEF1A2 antibody

EEF1A2 Antibody
DF9493 200ul
EUR 304.00
Description: EEF1A2 Antibody detects endogenous levels of total EEF1A2.

EEF1A2 Antibody
1-CSB-PA007412ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A2. Recognizes EEF1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EEF1A2 Antibody
1-CSB-PA007412ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A2. Recognizes EEF1A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EEF1A2 Antibody
1-CSB-PA007412GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EEF1A2. Recognizes EEF1A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pOTB7-EEF1A2
PVT18428 2 ug
EUR 231.00

EEF1A2 Conjugated Antibody
C45965 100ul
EUR 397.00

Human EEF1a2 Protein
20-abx650911
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

anti- EEF1A2 antibody
FNab02642 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: eukaryotic translation elongation factor 1 alpha 2
  • Uniprot ID: Q05639
  • Gene ID: 1917
  • Research Area: Metabolism
Description: Antibody raised against EEF1A2

EEF1A2 Rabbit pAb
A2473-100ul 100 ul
EUR 308.00

EEF1A2 Rabbit pAb
A2473-200ul 200 ul
EUR 459.00

EEF1A2 Rabbit pAb
A2473-20ul 20 ul
EUR 183.00

EEF1A2 Rabbit pAb
A2473-50ul 50 ul
EUR 223.00

EEF1A2 Rabbit pAb
A7327-100ul 100 ul
EUR 308.00

EEF1A2 Rabbit pAb
A7327-200ul 200 ul
EUR 459.00

EEF1A2 Rabbit pAb
A7327-20ul 20 ul
EUR 183.00

EEF1A2 Rabbit pAb
A7327-50ul 50 ul
EUR 223.00

EEF1A2 Blocking Peptide
33R-9588 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A2 antibody, catalog no. 70R-3046

EEF1A2 Blocking Peptide
DF9493-BP 1mg
EUR 195.00

Anti-EEF1A2 antibody
PAab02642 100 ug
EUR 355.00

Recombinant Human EEF1A2
P0565 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q05639
Description: Recombinant Human protein for EEF1A2

pCMV-SPORT6-EEF1A2
PVT14336 2 ug
EUR 495.00

Anti-EEF1A2 antibody
STJ72917 100 µg
EUR 359.00

Anti-EEF1A2 antibody
STJ11100935 100 µl
EUR 277.00
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer.

Rat EEF1A2 shRNA Plasmid
20-abx984646
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF1A2 ELISA KIT|Human
EF009296 96 Tests
EUR 689.00

EEF1A1 / EEF1A2 / EEF1A1P5 Antibody
20-abx327705
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human EEF1A2 shRNA Plasmid
20-abx951333
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse EEF1A2 shRNA Plasmid
20-abx970114
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF1A1/EEF1A2/EEF1A1P5 Antibody
1-CSB-PA005918
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A2 Recombinant Protein (Human)
RP010195 100 ug Ask for price

EEF1A2 Recombinant Protein (Rat)
RP199082 100 ug Ask for price

EEF1A2 Recombinant Protein (Mouse)
RP130898 100 ug Ask for price

Anti-eEF1A2 (Ser358) antibody
STJ120062 100 µl
EUR 526.00

eEF1A2 binding protein Polyclonal Antibody
EA194-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/ Rat/ Mouse/ Pg. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
EA194-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/ Rat/ Mouse/ Pg. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
EA252-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/ Rat/ Mouse/ Pig. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
EA252-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/ Rat/ Mouse/ Pig. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
ES8281-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/Rat/Mouse/Pig. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
ES8281-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against eEF1A2 binding protein from Human/Rat/Mouse/Pig. This antibody is tested and validated for WB, ELISA, IHC

eEF1A2 binding protein Polyclonal Antibody
ABP57282-003ml 0.03ml
EUR 158.00
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF1A2 binding protein from Human, Mouse, Rat, Pig. This eEF1A2 binding protein antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

eEF1A2 binding protein Polyclonal Antibody
ABP57282-01ml 0.1ml
EUR 289.00
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF1A2 binding protein from Human, Mouse, Rat, Pig. This eEF1A2 binding protein antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

eEF1A2 binding protein Polyclonal Antibody
ABP57282-02ml 0.2ml
EUR 414.00
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF1A2 binding protein from Human, Mouse, Rat, Pig. This eEF1A2 binding protein antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Anti-eEF1A2 binding protein Antibody
A14038 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for eEF1A2 binding protein Antibody (IGFN1) detection. Tested with WB, IHC in Human, Mouse, Rat, Pig.

EEF1A2 ORF Vector (Human) (pORF)
ORF003399 1.0 ug DNA
EUR 95.00

Eef1a2 ORF Vector (Rat) (pORF)
ORF066362 1.0 ug DNA
EUR 506.00

anti-eEF1A2 binding protein (5B12)
LF-MA10086 100 ug
EUR 363.00
Description: Mouse monoclonal to eEF1A2 binding protein

Eef1a2 ORF Vector (Mouse) (pORF)
ORF043634 1.0 ug DNA
EUR 506.00

Anti-Phospho-eEF1A2 (Ser358) Antibody
P03304 100ul
EUR 398.00
Description: Rabbit Polyclonal Phospho-eEF1A2 (Ser358) Antibody. Validated in WB and tested in Mouse.

Anti-eEF1A2 binding protein antibody
STJ97490 200 µl
EUR 197.00
Description: Rabbit polyclonal to eEF1A2 binding protein.

EEF1A2 sgRNA CRISPR Lentivector set (Human)
K0655101 3 x 1.0 ug
EUR 339.00

Eef1a2 sgRNA CRISPR Lentivector set (Mouse)
K3721701 3 x 1.0 ug
EUR 339.00

Eef1a2 sgRNA CRISPR Lentivector set (Rat)
K6923401 3 x 1.0 ug
EUR 339.00

EEF1A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0655102 1.0 ug DNA
EUR 154.00

EEF1A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0655103 1.0 ug DNA
EUR 154.00

EEF1A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0655104 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3721702 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3721703 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3721704 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6923402 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6923403 1.0 ug DNA
EUR 154.00

Eef1a2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6923404 1.0 ug DNA
EUR 154.00

EEF1A2 Protein Vector (Mouse) (pPB-C-His)
PV174534 500 ng
EUR 603.00

EEF1A2 Protein Vector (Mouse) (pPB-N-His)
PV174535 500 ng
EUR 603.00

EEF1A2 Protein Vector (Mouse) (pPM-C-HA)
PV174536 500 ng
EUR 603.00

EEF1A2 Protein Vector (Mouse) (pPM-C-His)
PV174537 500 ng
EUR 603.00

EEF1A2 Protein Vector (Human) (pPB-C-His)
PV013593 500 ng
EUR 329.00

EEF1A2 Protein Vector (Human) (pPB-N-His)
PV013594 500 ng
EUR 329.00

EEF1A2 Protein Vector (Human) (pPM-C-HA)
PV013595 500 ng
EUR 329.00

EEF1A2 Protein Vector (Human) (pPM-C-His)
PV013596 500 ng
EUR 329.00

EEF1A2 Protein Vector (Rat) (pPB-C-His)
PV265446 500 ng
EUR 603.00

EEF1A2 Protein Vector (Rat) (pPB-N-His)
PV265447 500 ng
EUR 603.00

EEF1A2 Protein Vector (Rat) (pPM-C-HA)
PV265448 500 ng
EUR 603.00

EEF1A2 Protein Vector (Rat) (pPM-C-His)
PV265449 500 ng
EUR 603.00

Eef1a2 3'UTR Luciferase Stable Cell Line
TU203788 1.0 ml Ask for price

Eef1a2 3'UTR GFP Stable Cell Line
TU155610 1.0 ml Ask for price

EEF1A2 3'UTR Luciferase Stable Cell Line
TU006615 1.0 ml
EUR 1394.00

Eef1a2 3'UTR Luciferase Stable Cell Line
TU105610 1.0 ml Ask for price

EEF1A2 3'UTR GFP Stable Cell Line
TU056615 1.0 ml
EUR 1394.00

Eef1a2 3'UTR GFP Stable Cell Line
TU253788 1.0 ml Ask for price

EEF1A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV678607 1.0 ug DNA
EUR 682.00

EEF1A2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV678611 1.0 ug DNA
EUR 682.00

EEF1A2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV678612 1.0 ug DNA
EUR 682.00

Bovine Elongation factor 1- alpha 2, EEF1A2 ELISA KIT
ELI-26629b 96 Tests
EUR 928.00

Human Elongation factor 1- alpha 2, EEF1A2 ELISA KIT
ELI-09299h 96 Tests
EUR 824.00

Rat Elongation factor 1- alpha 2, Eef1a2 ELISA KIT
ELI-09300r 96 Tests
EUR 886.00

Rabbit Elongation factor 1- alpha 2, EEF1A2 ELISA KIT
ELI-09609Ra 96 Tests
EUR 928.00

Mouse Elongation factor 1- alpha 2, Eef1a2 ELISA KIT
ELI-32725m 96 Tests
EUR 865.00

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx126892
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx112350
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
abx026885-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
abx026885-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx321863
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx321864
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx215074
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human Elongation Factor 1 Alpha 2 (EEF1A2) ELISA Kit
abx387052-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
abx431222-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
20-abx225152
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1A2) Antibody
abx232642-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Recombinant Eukaryotic Translation Elongation Factor 1 Alpha 2 (EEF1a2)
4-RPF021Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q05639
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.7kDa
  • Isoelectric Point: 9.4
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Alpha 2 expressed in: E.coli

EEF1A2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0655105 3 x 1.0 ug
EUR 376.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3721705 3 x 1.0 ug
EUR 376.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6923405 3 x 1.0 ug
EUR 376.00

Polyclonal Phospho-Ser358 Eukaryotic Elongation Factor 1 alpha 2 (eEF1A2) Antibody
APR03408G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-Ser358 Eukaryotic Elongation Factor 1 alpha 2 (eEF1A2) . This antibody is tested and proven to work in the following applications:

EEF1A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0655106 1.0 ug DNA
EUR 167.00

EEF1A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0655107 1.0 ug DNA
EUR 167.00

EEF1A2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0655108 1.0 ug DNA
EUR 167.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3721706 1.0 ug DNA
EUR 167.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3721707 1.0 ug DNA
EUR 167.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3721708 1.0 ug DNA
EUR 167.00

EEF1A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV678608 1.0 ug DNA
EUR 682.00

EEF1A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV678609 1.0 ug DNA
EUR 740.00

EEF1A2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV678610 1.0 ug DNA
EUR 740.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6923406 1.0 ug DNA
EUR 167.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6923407 1.0 ug DNA
EUR 167.00

Eef1a2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6923408 1.0 ug DNA
EUR 167.00

A number of different research investigating the advantages of ivermectin for malaria functions are ongoing/deliberate.Whereas ivermectin MDA provides promising views within the combat in opposition to malaria, we spotlight the added advantages and anticipated challenges of conducting future research in onchocerciasis-endemic areas, that are confronted with a considerable illness burden together with onchocerciasis-associated epilepsy.

Rising the frequency of ivermectin MDA in such locations could scale back the burden of each malaria and onchocerciasis, and permit for extra entomological investigations on each the Anopheles mosquitoes and the blackflies.

Upfront, acceptability and feasibility research are wanted to evaluate the endorsement by the native populations, in addition to the programmatic feasibility of implementing ivermectin MDA a number of occasions a yr.Onchocerciasis-endemic websites would doubly profit from ivermectin MDA interventions, as these will alleviate onchocerciasis-associated morbidity and mortality, whereas doubtlessly curbing malaria transmission. Involving onchocerciasis applications and different related stakeholders within the malaria/ivermectin analysis agenda would foster the implementation of pluri-annual MDA in goal communities.

The ZT Biopolymer: A Self-Assembling Protein Scaffold for Stem Cell Applications.

by
The ZT Biopolymer: A Self-Assembling Protein Scaffold for Stem Cell Applications.

The event of cell tradition programs for the naturalistic propagation, self-renewal and differentiation of cells ex vivo is a excessive purpose of molecular engineering. Regardless of vital success in recent times, the excessive value of up-scaling cultures, the necessity for xeno-free tradition situations, and the diploma of mimicry of the natural extracellular matrix attainable in vitro utilizing designer substrates proceed to pose obstacles to the interpretation of cell-based technologies.

On this regard, the ZT biopolymer is a protein-based, steady, scalable, and economical cell substrate of excessive promise. ZT relies on the naturally occurring meeting of two human proteins: titin-Z1Z2 and telethonin. These protein constructing blocks are strong scaffolds that may be conveniently functionalized with full-length proteins and bioactive peptidic motifs by genetic manipulation, previous to self-assembly.

The polymer is, thereby, totally encodable. Functionalized variations of the ZT polymer have been proven to efficiently maintain the long-term culturing of human embryonic stem cells (hESCs), human induced pluripotent stem cells (hiPSCs), and murine mesenchymal stromal cells (mMSCs).

Pluripotency of hESCs and hiPSCs was retained for the longest interval assayed (four months). Outcomes level to the big potential of the ZT system for the creation of a modular, pluri-functional biomaterial for cell-based purposes.

The ZT Biopolymer: A Self-Assembling Protein Scaffold for Stem Cell Applications.

Maxwell®: An Unsupervised Studying Method for 5P Medication.

Within the 5P medication (Customized, Preventive, Participative, Predictive and Pluri-expert), the final pattern is to course of information by displacing the barycenter of the data from hospital centered programs to the affected person centered ones by his private medical information.

Mouse Epidermal Growth Factor (EGF) ELISA Kit, 96 tests, quantitative
210-150-EGF 1 Kit
EUR 773.00

Human Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Hu-48T 48T
EUR 317.00
  • Should the Human Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Hu-96T 96T
EUR 398.00
  • Should the Human Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Mu-48T 48T
EUR 315.00
  • Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Mu-96T 96T
EUR 396.00
  • Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-p-48T 48T
EUR 493.00
  • Should the Porcine Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-p-96T 96T
EUR 641.00
  • Should the Porcine Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Ra-48T 48T
EUR 372.00
  • Should the Rat Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Ra-96T 96T
EUR 475.00
  • Should the Rat Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Hu-48Tests 48 Tests
EUR 307.00

Human Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Hu-96Tests 96 Tests
EUR 418.00

Mouse Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Mu-48Tests 48 Tests
EUR 305.00

Mouse Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Mu-96Tests 96 Tests
EUR 415.00

Porcine Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-p-48Tests 48 Tests
EUR 516.00

Porcine Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-p-96Tests 96 Tests
EUR 716.00

Rat Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Ra-48Tests 48 Tests
EUR 374.00

Rat Epidermal Growth Factor (EGF) ELISA Kit
RDR-EGF-Ra-96Tests 96 Tests
EUR 512.00

Human Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Hu-48Tests 48 Tests
EUR 295.00

Human Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Hu-96Tests 96 Tests
EUR 400.00

Mouse Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Mu-48Tests 48 Tests
EUR 293.00

Mouse Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Mu-96Tests 96 Tests
EUR 398.00

Porcine Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-p-48Tests 48 Tests
EUR 494.00

Porcine Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-p-96Tests 96 Tests
EUR 684.00

Rat Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Ra-48Tests 48 Tests
EUR 358.00

Rat Epidermal Growth Factor (EGF) ELISA Kit
RD-EGF-Ra-96Tests 96 Tests
EUR 490.00

EGF
E13-007-1 10μg
EUR 83.00

EGF
E13-007-2 50μg
EUR 115.00

EGF
E21-029 10ug
EUR 343.00

EGF
PR27006 500 ug
EUR 318.00

EGF
PR27009 500 ug
EUR 318.00

EGF
MO15063 100 ug
EUR 409.00

EGF
LF-PR003 200 ug
EUR 142.00
Description: EGF protein

rHu EGF
AK8327-0100 100µg Ask for price

rHu EGF
AK8327-0500 500µg Ask for price

rHu EGF
AK8327-1000 1mg Ask for price

EGF Antibody
AF5148 200ul
EUR 304.00
Description: EGF Antibody detects endogenous levels of total EGF.

EGF siRNA
20-abx901657
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EGF Antibody
BF0066 200ul
EUR 376.00
Description: EGF antibody detects endogenous levels of total EGF.

His-EGF
E13-006-1 10μg
EUR 83.00

His-EGF
E13-006-2 50μg
EUR 115.00

EGF, Mouse
HY-P7067 100ug
EUR 187.00

EGF, Rat
HY-P7092 50ug
EUR 211.00

EGF, Human
HY-P7109 50ug
EUR 108.00

EGF Protein
abx069820-1mg 1 mg
EUR 1080.00
  • Shipped within 5-10 working days.

EGF Protein
abx169012-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

EGF Antibody
ABF5148 100 ug
EUR 438.00

EGF siRNA
20-abx915073
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EGF siRNA
20-abx915074
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EGF antibody
70R-5697 50 ug
EUR 467.00
Description: Rabbit polyclonal EGF antibody

EGF antibody
70R-EG001 50 ug
EUR 273.00
Description: Affinity purified Goat polyclonal EGF antibody

EGF antibody
70R-ER012 50 ug
EUR 273.00
Description: Affinity purified Rabbit polyclonal EGF antibody

EGF Antibody
ABD2225 100 ug
EUR 438.00

EGF Antibody
ABD7063 100 ug
EUR 438.00

EGF Antibody
35720-100ul 100ul
EUR 252.00

EGF antibody
38447-100ul 100ul
EUR 252.00

EGF Antibody
49545-100ul 100ul
EUR 333.00

EGF Antibody
49545-50ul 50ul
EUR 239.00

EGF Antibody
5022-100
EUR 316.00

EGF Antibody
5022-30T
EUR 146.00

EGF Antibody
5023R-100
EUR 316.00

EGF Antibody
5023R-30T
EUR 146.00

EGF antibody
10-E39A 500 ug
EUR 566.00
Description: Mouse monoclonal EGF antibody

EGF antibody
10R-7766 500 ug
EUR 565.00
Description: Mouse monoclonal EGF antibody

EGF protein
30R-1056 100 ug
EUR 268.00
Description: Purified recombinant Human EGF protein

EGF protein
30R-2331 500 ug
EUR 317.00
Description: Purified recombinant Human EGF protein

EGF protein
30R-2332 500 ug
EUR 325.00
Description: Purified recombinant Mouse EGF protein

EGF protein
30R-2333 20 ug
EUR 210.00
Description: Purified recombinant Rat EGF protein

EGF protein
30R-AE003 1 mg
EUR 381.00
Description: Purified recombinant Human EGF protein

EGF protein
30R-AE004 100 ug
EUR 133.00
Description: Purified recombinant Human EGF protein

EGF protein
30R-AE025 100 ug
EUR 273.00
Description: Purified recombinant Human EGF protein

EGF antibody
10R-2038 100 ul
EUR 403.00
Description: Mouse monoclonal EGF antibody

EGF antibody
10R-2176 100 ul
EUR 403.00
Description: Mouse monoclonal EGF antibody

EGF antibody
10R-2969 100 ug
EUR 265.00
Description: Mouse monoclonal EGF antibody

EGF antibody
10R-2985 100 ug
EUR 265.00
Description: Mouse monoclonal EGF antibody

EGF antibody
20C-CR1085GP 100 ug
EUR 148.00
Description: Goat polyclonal EGF antibody

EGF antibody
20R-1772 100 ug
EUR 673.00
Description: Rabbit polyclonal EGF antibody

EGF antibody
70R-12248 100 ug
EUR 403.00
Description: Rabbit polyclonal EGF antibody

EGF antibody
70R-12249 100 ug
EUR 403.00
Description: Rabbit polyclonal EGF antibody

EGF antibody
70R-13940 100 ug
EUR 322.00
Description: Affinity purified Goat polyclonal EGF antibody

EGF antibody
70-ER40 50 ug
EUR 284.00
Description: Affinity purified Rabbit polyclonal EGF antibody

EGF antibody
70R-15294 100 ug
EUR 327.00
Description: Rabbit polyclonal EGF antibody

EGF Antibody
DF7063 200ul
EUR 304.00
Description: EGF Antibody detects endogenous levels of total EGF.

EGF Antibody
1-CSB-PA942209
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGF. Recognizes EGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

EGF Antibody
DF2225 200ul
EUR 304.00
Description: EGF antibody detects endogenous levels of total EGF.

EGF Antibody
1-CSB-PA007939
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EGF. Recognizes EGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EGF Antibody
1-CSB-PA846755
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EGF. Recognizes EGF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

egf Antibody
1-CSB-PA24449A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against egf. Recognizes egf from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

EGF Antibody
1-CSB-PA06244A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EGF. Recognizes EGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

EGF Pichia
PR27007 500 ug
EUR 318.00

ISOKine-EGF
PR80002 100 ug
EUR 344.00

EGF Mouse
P2558-.1 100 µg
EUR 108.00

EGF Mouse
P2558-.5 500 µg
EUR 200.00

EGF Mouse
P2558-1 1 mg
EUR 311.00

anti-EGF
YF-PA23628 50 ul
EUR 334.00
Description: Mouse polyclonal to EGF

HB-EGF/ Rat HB- EGF ELISA Kit
ELA-E1479r 96 Tests
EUR 886.00

Polyclonal EGF Antibody
APR00243G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGF . This antibody is tested and proven to work in the following applications:

Polyclonal EGF Antibody
APR00244G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGF . This antibody is tested and proven to work in the following applications:

rHu EGF (cGMP)
AK9797-0040 40ug Ask for price

rHu EGF (cGMP)
AK9797-0100 100µg Ask for price

rHu HB-EGF
AK9962-0010 10µg Ask for price

rHu HB-EGF
AK9962-0050 50µg Ask for price

rHu HB-EGF
AK9962-0100 100µg Ask for price

rHu HB-EGF
AK9962-1000 1mg Ask for price

EGF Blocking Peptide
AF5148-BP 1mg
EUR 195.00

EGF Conjugated Antibody
C38447 100ul
EUR 397.00

EGF Conjugated Antibody
C49545 100ul
EUR 397.00

EGF Blocking Peptide
BF0066-BP 1mg
EUR 195.00

EGF Conjugated Antibody
C35720 100ul
EUR 397.00

EGF cloning plasmid
CSB-CL007473HU-10ug 10ug
EUR 1280.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3624
  • Sequence: ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACTTGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGA
  • Show more
Description: A cloning plasmid for the EGF gene.

rec EGF (human)
H-7490.0100 0.1mg
EUR 162.00
Description: Sum Formula: C270H395N73O83S7; CAS# [62253-63-8]

rec EGF (human)
H-7490.0500 0.5mg
EUR 381.00
Description: Sum Formula: C270H395N73O83S7; CAS# [62253-63-8]

EGF Polyclonal Antibody
ES5049-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against EGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EGF Polyclonal Antibody
ES5049-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against EGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EGF Polyclonal Antibody
ES8651-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against EGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EGF Polyclonal Antibody
ES8651-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against EGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

HB-EGF, Human
HY-P7017 100ug
EUR 360.00

HB-EGF, Mouse
HY-P7194 50ug
EUR 268.00

EGF Polyclonal Antibody
ABP58462-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060

EGF Polyclonal Antibody
ABP58462-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060

EGF Polyclonal Antibody
ABP58462-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060

EGF Protein (OVA)
20-abx165531
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Human EGF Protein
20-abx060144
  • EUR 244.00
  • EUR 432.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EGF Polyclonal Antibody
ABP54050-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human EGF
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF

EGF Polyclonal Antibody
ABP54050-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human EGF
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF

EGF Polyclonal Antibody
ABP54050-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human EGF
  • Applications tips:
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF

Pro-EGF Antibody
abx433183-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Anti-EGF Antibody
A00378 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for EGF Antibody (EGF) detection.tested for WB in Human, Mouse, Rat.

Anti-EGF Antibody
A00378-1 100ug/vial
EUR 334.00

EGF Rabbit pAb
A12916-100ul 100 ul
EUR 308.00

In the present day, using synthetic intelligence for supporting this transition exhibits actual limitations in its implementation in operational follow, each on the stage of affected person care, but in addition within the basic each day lifetime of the well being skilled, due to the medico-legal imperatives induced by the guarantees of the ‘5P medication’.

On this paper, we suggest to fill this hole by introducing an authentic synthetic intelligence platform, named Maxwell, which follows an unsupervised studying method consistent with the medico-legal imperatives of the ‘5P medication’. We describe the useful platform traits and illustrate them by two examples of clustering in genomics and magnetic resonance imaging.