Simultaneous presence of different Borrelia burgdorferi genospecies in biological fluids of Lyme disease patients.

Oligonucleotide primers based mostly on Borrelia burgdorferi sensu lato ospA gene sequences have been designed to be used within the PCR to kind all (SL primers) or every (GI to GIII primers) of the B. burgdorferi sensu lato genospecies concerned in Lyme illness. These genospecies-specific primers have been then used within the PCR on 24 organic fluids collected from 18 neuroborreliosis sufferers.

Among the many samples examined, 20 contained DNA from Borrelia garinii, 11 contained DNA from B. burgdorferi sensu stricto, and 10 contained DNA from Borrelia afzelii. In toto, 10 sufferers appeared to have been contaminated by a single genospecies and eight have been contaminated by a couple of Lyme disease-associated genospecies. Serum specimens from six sufferers have been absorbed with heterologous antigens and examined by Western blotting (immunoblotting).

In 4 instances, residual immunodetection revealed particular epitopes of genospecies additionally detected by PCR; in two of them, the concordant outcomes indicated pluri-infection of the sufferers. Within the different two instances, Western blotting confirmed particular antibodies for 2 genospecies of Borrelia, whereas PCR detected DNA from just one. In abstract, the information underscored the comparatively excessive prevalence of pluri-infections in Lyme illness and confirmed the affiliation of B. garinii with neuroborreliosis.

Essential roles of sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells.

Human embryonic stem cells (hESCs) have nice potential to be used in analysis and regenerative medication, however little or no is understood concerning the elements that keep these cells within the pluripotent state. We investigated the position of three main mitogenic brokers current in serum–sphingosine-1-phosphate (S1P), lysophosphatidic acid (LPA), and platelet-derived progress issue (PDGF)–in sustaining hESCs.

EEF1B2 antibody

70R-49683 100 ul
EUR 244.00
Description: Purified Polyclonal EEF1B2 antibody

EEF1B2 antibody

70R-2143 50 ug
EUR 467.00
Description: Rabbit polyclonal EEF1B2 antibody raised against the middle region of EEF1B2

EEF1B2 antibody

39022-100ul 100ul
EUR 252.00

EEF1B2 Antibody

43073-100ul 100ul
EUR 252.00

EEF1B2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1B2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EEF1B2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EEF1B2 Conjugated Antibody

C39022 100ul
EUR 397.00

EEF1B2 Conjugated Antibody

C43073 100ul
EUR 397.00

EEF1B2 cloning plasmid

CSB-CL335050HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
  • Show more
Description: A cloning plasmid for the EEF1B2 gene.

EEF1B2 cloning plasmid

CSB-CL335050HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
  • Show more
Description: A cloning plasmid for the EEF1B2 gene.

anti- EEF1B2 antibody

FNab02643 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody

FNab02644 100µg
EUR 505.25
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody

FNab02645 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:50-1:500
  • Immunogen: eukaryotic translation elongation factor 1 beta 2
  • Uniprot ID: P24534
  • Gene ID: 1933
  • Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

EEF1B2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF1B2 Blocking Peptide

33R-9624 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1B2 antibody, catalog no. 70R-2143

Anti-EEF1B2 antibody

PAab02643 100 ug
EUR 355.00

Anti-EEF1B2 antibody

PAab02644 100 ug
EUR 355.00

Anti-EEF1B2 antibody

STJ28663 100 µl
EUR 413.00
Description: This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR.

Anti-eEF1B2 (3A5)

YF-MA12778 100 ug
EUR 363.00
Description: Mouse monoclonal to eEF1B2


EF009297 96 Tests
EUR 689.00

Human EEF1B2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF1B2 protein (His tag)

80R-1704 10 ug
EUR 305.00
Description: Purified recombinant Human EEF1B2 protein

EEF1B2 Recombinant Protein (Human)

RP010198 100 ug Ask for price

EEF1B2 Recombinant Protein (Human)

RP010201 100 ug Ask for price

EEF1B2 Recombinant Protein (Rat)

RP199085 100 ug Ask for price

EEF1B2 Recombinant Protein (Mouse)

RP130901 100 ug Ask for price

[KO Validated] EEF1B2 Rabbit pAb

A6580-100ul 100 ul
EUR 410.00

[KO Validated] EEF1B2 Rabbit pAb

A6580-200ul 200 ul
EUR 571.00

[KO Validated] EEF1B2 Rabbit pAb

A6580-20ul 20 ul
EUR 221.00

[KO Validated] EEF1B2 Rabbit pAb

A6580-50ul 50 ul
EUR 287.00

EEF1B2 ORF Vector (Human) (pORF)

ORF003400 1.0 ug DNA
EUR 95.00

EEF1B2 ORF Vector (Human) (pORF)

ORF003401 1.0 ug DNA
EUR 95.00

Eef1b2 ORF Vector (Rat) (pORF)

ORF066363 1.0 ug DNA
EUR 506.00

Eef1b2 ORF Vector (Mouse) (pORF)

ORF043635 1.0 ug DNA
EUR 506.00

EEF1B2 sgRNA CRISPR Lentivector set (Human)

K0656701 3 x 1.0 ug
EUR 339.00

Eef1b2 sgRNA CRISPR Lentivector set (Rat)

K6406801 3 x 1.0 ug
EUR 339.00

Human Elongation factor 1-beta (EEF1B2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 51.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-beta(EEF1B2) expressed in E.coli

Eef1b2 sgRNA CRISPR Lentivector set (Mouse)

K4892201 3 x 1.0 ug
EUR 339.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0656702 1.0 ug DNA
EUR 154.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0656703 1.0 ug DNA
EUR 154.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0656704 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6406802 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6406803 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6406804 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892202 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892203 1.0 ug DNA
EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892204 1.0 ug DNA
EUR 154.00

EEF1B2 Protein Vector (Mouse) (pPB-C-His)

PV174538 500 ng
EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPB-N-His)

PV174539 500 ng
EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPM-C-HA)

PV174540 500 ng
EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPM-C-His)

PV174541 500 ng
EUR 603.00

EEF1B2 Protein Vector (Human) (pPB-C-His)

PV013597 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-N-His)

PV013598 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-HA)

PV013599 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-His)

PV013600 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-C-His)

PV013601 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-N-His)

PV013602 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-HA)

PV013603 500 ng
EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-His)

PV013604 500 ng
EUR 329.00

EEF1B2 Protein Vector (Rat) (pPB-C-His)

PV265450 500 ng
EUR 603.00

EEF1B2 Protein Vector (Rat) (pPB-N-His)

PV265451 500 ng
EUR 603.00

EEF1B2 Protein Vector (Rat) (pPM-C-HA)

PV265452 500 ng
EUR 603.00

EEF1B2 Protein Vector (Rat) (pPM-C-His)

PV265453 500 ng
EUR 603.00

Eef1b2 3'UTR Luciferase Stable Cell Line

TU203789 1.0 ml Ask for price

Eef1b2 3'UTR GFP Stable Cell Line

TU155611 1.0 ml Ask for price

EEF1B2 3'UTR Luciferase Stable Cell Line

TU006618 1.0 ml
EUR 1521.00

Eef1b2 3'UTR Luciferase Stable Cell Line

TU105611 1.0 ml Ask for price

EEF1B2 3'UTR GFP Stable Cell Line

TU056618 1.0 ml
EUR 1521.00

Eef1b2 3'UTR GFP Stable Cell Line

TU253789 1.0 ml Ask for price

Human Elongation factor 1- beta, EEF1B2 ELISA KIT

ELI-09610h 96 Tests
EUR 824.00

Human Elongation Factor 1 Beta (EEF1B2) ELISA Kit

abx387053-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709587 1.0 ug DNA
EUR 316.00

EEF1B2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709591 1.0 ug DNA
EUR 316.00

EEF1B2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709592 1.0 ug DNA
EUR 316.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-100ug

QP7171-ec-100ug 100ug
EUR 408.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-10ug

QP7171-ec-10ug 10ug
EUR 200.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-1mg

QP7171-ec-1mg 1mg
EUR 1632.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-200ug

QP7171-ec-200ug 200ug
EUR 634.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-500ug

QP7171-ec-500ug 500ug
EUR 1060.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-50ug

QP7171-ec-50ug 50ug
EUR 263.00

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

abx232643-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

abx232644-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody

abx232645-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Recombinant Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P24534
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Beta 2 expressed in: E.coli

Human Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0656705 3 x 1.0 ug
EUR 376.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6406805 3 x 1.0 ug
EUR 376.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4892205 3 x 1.0 ug
EUR 376.00

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0656706 1.0 ug DNA
EUR 167.00

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0656707 1.0 ug DNA
EUR 167.00

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0656708 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6406806 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6406807 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6406808 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4892206 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4892207 1.0 ug DNA
EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4892208 1.0 ug DNA
EUR 167.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV709588 1.0 ug DNA
EUR 316.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV709589 1.0 ug DNA
EUR 374.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV709590 1.0 ug DNA
EUR 374.00

EEF1B2 Eukaryotic Translation Elongation Factor 1 Beta 2 Human Recombinant Protein

PROTP24534 Regular: 5ug
EUR 317.00
Description: EEF1B2 Human Recombinant fused with an 8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 233 amino acids (1-225 a.a.) and having a molecular mass of 25.8kDa. The EEF1B2 is purified by proprietary chromatographic techniques.

We present right here that though LPA doesn’t have an effect on hESC progress or differentiation, coincubation of S1P and PDGF in a serum-free tradition medium efficiently maintains hESCs in an undifferentiated state. Our research point out that signaling pathways activated by tyrosine kinase receptors act synergistically with these downstream from lysophospholipid receptors to keep up hESCs within the undifferentiated state. This research is the primary demonstration of a task for lysophospholipid receptor signaling within the upkeep of stem cell pluri-potentiality.