Synapse formation and establishment of neuronal polarity by P19 embryonic carcinoma cells and embryonic stem cells.

Various totally different cell strains that exhibit a partial neuronal phenotype have been recognized, however in lots of circumstances the complete extent of their neuronal differentiation has not been instantly addressed by useful research. We have now used electrophysiology and immunofluorescence to look at the formation of synapses and the event of neuronal polarity by murine embryonic stem (ES) cells and the mouse P19 embryonic carcinoma cell line.

Inside 2-Three weeks after induction by retinoic acid, subsets of P19 and ES cells shaped excitatory synapses, mediated by glutamate receptors, or inhibitory synapses, mediated by receptors for GABA or glycine. In ES-cell cultures, each NMDA and non-NMDA receptors contributed to the excitatory postsynaptic response.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF1D Antibody

ABD6974 100 ug
EUR 438.00

EEF1D antibody

38412-100ul 100ul
EUR 252.00

EEF1D antibody

70R-17002 50 ul
EUR 435.00
Description: Rabbit polyclonal EEF1D antibody

EEF1D Antibody

DF6974 200ul
EUR 304.00
Description: EEF1D Antibody detects endogenous levels of total EEF1D.

EEF1D Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

EEF1D Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000


YF-PA11496 50 ug
EUR 363.00
Description: Mouse polyclonal to EEF1D


YF-PA11497 100 ug
EUR 403.00
Description: Rabbit polyclonal to EEF1D


YF-PA23623 50 ul
EUR 334.00
Description: Mouse polyclonal to EEF1D

Polyclonal EEF1D Antibody

AMM07014G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D . This antibody is tested and proven to work in the following applications:

EEF1D Conjugated Antibody

C38412 100ul
EUR 397.00

EEF1D cloning plasmid

CSB-CL007431HU1-10ug 10ug
EUR 654.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1944
  • Sequence: atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgagg
  • Show more
Description: A cloning plasmid for the EEF1D gene.

EEF1D cloning plasmid

CSB-CL007431HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 846
  • Sequence: atggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaa
  • Show more
Description: A cloning plasmid for the EEF1D gene.

anti- EEF1D antibody

FNab02646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metab
  • Show more
Description: Antibody raised against EEF1D

anti- EEF1D antibody

FNab02647 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

anti- EEF1D antibody

FNab02648 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

EEF1D Polyclonal Antibody

A54224 100 µg
EUR 570.55
Description: Ask the seller for details

EEF1D Rabbit pAb

A2509-100ul 100 ul
EUR 308.00

EEF1D Rabbit pAb

A2509-200ul 200 ul
EUR 459.00

EEF1D Rabbit pAb

A2509-20ul 20 ul
EUR 183.00

EEF1D Rabbit pAb

A2509-50ul 50 ul
EUR 223.00

EEF1D Blocking Peptide

DF6974-BP 1mg
EUR 195.00

Anti-EEF1D antibody

PAab02646 100 ug
EUR 355.00

Anti-EEF1D antibody

STJ23477 100 µl
EUR 277.00
Description: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.

Anti-EEF1D (4B12)

YF-MA10264 100 ug
EUR 363.00
Description: Mouse monoclonal to EEF1D

Mouse EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF009298 96 Tests
EUR 689.00

Human EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF1D protein (His tag)

80R-1713 50 ug
EUR 397.00
Description: Purified recombinant Human EEF1D protein

EEF1D Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1D Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1D Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EEF1D Recombinant Protein (Human)

RP010204 100 ug Ask for price

EEF1D Recombinant Protein (Human)

RP010207 100 ug Ask for price

EEF1D Recombinant Protein (Rat)

RP199088 100 ug Ask for price

EEF1D Recombinant Protein (Mouse)

RP130904 100 ug Ask for price

EEF1D Recombinant Protein (Mouse)

RP130907 100 ug Ask for price

Polyclonal EEF1D Antibody (N-term)

AMM07016G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D (N-term). This antibody is tested and proven to work in the following applications:

EEF1D Polyclonal Antibody, Biotin Conjugated

A54221 100 µg
EUR 570.55
Description: reagents widely cited

EEF1D Polyclonal Antibody, FITC Conjugated

A54222 100 µg
EUR 570.55
Description: Ask the seller for details

EEF1D Polyclonal Antibody, HRP Conjugated

A54223 100 µg
EUR 570.55
Description: The best epigenetics products

EEF1D ORF Vector (Human) (pORF)

ORF003402 1.0 ug DNA
EUR 95.00

EEF1D ORF Vector (Human) (pORF)

ORF003403 1.0 ug DNA
EUR 95.00

Eef1d ORF Vector (Rat) (pORF)

ORF066364 1.0 ug DNA
EUR 506.00

Eef1d ORF Vector (Mouse) (pORF)

ORF043636 1.0 ug DNA
EUR 506.00

Eef1d ORF Vector (Mouse) (pORF)

ORF043637 1.0 ug DNA
EUR 506.00

EEF1D sgRNA CRISPR Lentivector set (Human)

K0657001 3 x 1.0 ug
EUR 339.00

Eef1d sgRNA CRISPR Lentivector set (Mouse)

K4608201 3 x 1.0 ug
EUR 339.00

Human Elongation factor 1-delta (EEF1D)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 35 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-delta(EEF1D) expressed in E.coli

Eef1d sgRNA CRISPR Lentivector set (Rat)

K7151201 3 x 1.0 ug
EUR 339.00

Monoclonal EEF1D Antibody (monoclonal) (M04), Clone: 4B12

AMM07015G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human EEF1D (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB and IF, E

EEF1D sgRNA CRISPR Lentivector (Human) (Target 1)

K0657002 1.0 ug DNA
EUR 154.00

EEF1D sgRNA CRISPR Lentivector (Human) (Target 2)

K0657003 1.0 ug DNA
EUR 154.00

EEF1D sgRNA CRISPR Lentivector (Human) (Target 3)

K0657004 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4608202 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4608203 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4608204 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 1)

K7151202 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 2)

K7151203 1.0 ug DNA
EUR 154.00

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 3)

K7151204 1.0 ug DNA
EUR 154.00

EEF1D Protein Vector (Mouse) (pPB-C-His)

PV174542 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-N-His)

PV174543 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-HA)

PV174544 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-His)

PV174545 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-C-His)

PV174546 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPB-N-His)

PV174547 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-HA)

PV174548 500 ng
EUR 603.00

EEF1D Protein Vector (Mouse) (pPM-C-His)

PV174549 500 ng
EUR 603.00

EEF1D Protein Vector (Human) (pPB-C-His)

PV013605 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPB-N-His)

PV013606 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-HA)

PV013607 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-His)

PV013608 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPB-C-His)

PV013609 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPB-N-His)

PV013610 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-HA)

PV013611 500 ng
EUR 329.00

EEF1D Protein Vector (Human) (pPM-C-His)

PV013612 500 ng
EUR 329.00

EEF1D Protein Vector (Rat) (pPB-C-His)

PV265454 500 ng
EUR 603.00

EEF1D Protein Vector (Rat) (pPB-N-His)

PV265455 500 ng
EUR 603.00

EEF1D Protein Vector (Rat) (pPM-C-HA)

PV265456 500 ng
EUR 603.00

EEF1D Protein Vector (Rat) (pPM-C-His)

PV265457 500 ng
EUR 603.00

Eef1d 3'UTR Luciferase Stable Cell Line

TU203790 1.0 ml Ask for price

Eef1d 3'UTR GFP Stable Cell Line

TU155612 1.0 ml Ask for price

EEF1D 3'UTR Luciferase Stable Cell Line

TU006621 1.0 ml
EUR 1394.00

Eef1d 3'UTR Luciferase Stable Cell Line

TU105612 1.0 ml Ask for price

EEF1D 3'UTR GFP Stable Cell Line

TU056621 1.0 ml
EUR 1394.00

Eef1d 3'UTR GFP Stable Cell Line

TU253790 1.0 ml Ask for price

Mouse Elongation factor 1- delta, Eef1d ELISA KIT

ELI-10015m 96 Tests
EUR 865.00

Bovine Elongation factor 1- delta, EEF1D ELISA KIT

ELI-09301b 96 Tests
EUR 928.00

Rabbit Elongation factor 1- delta, EEF1D ELISA KIT

ELI-47136Ra 96 Tests
EUR 928.00

Human Elongation factor 1- delta, EEF1D ELISA KIT

ELI-47510h 96 Tests
EUR 824.00

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx122804-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx032848-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx032848-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Human Elongation Factor 1 Delta (EEF1D) ELISA Kit

abx387054-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx232646-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx232647-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody

abx232648-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679495 1.0 ug DNA
EUR 682.00

EEF1D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679499 1.0 ug DNA
EUR 682.00

EEF1D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV679500 1.0 ug DNA
EUR 682.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV709593 1.0 ug DNA
EUR 316.00

EEF1D Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV709597 1.0 ug DNA
EUR 316.00

EEF1D Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV709598 1.0 ug DNA
EUR 316.00

Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d)

  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P29692
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli

Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P57776
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli

Human Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein

  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0657005 3 x 1.0 ug
EUR 376.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4608205 3 x 1.0 ug
EUR 376.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7151205 3 x 1.0 ug
EUR 376.00

EEF1D Eukaryotic Translation Elongation Factor 1 Delta Human Recombinant Protein

PROTP29692 Regular: 10ug
EUR 317.00
Description: EEF1D Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 301 amino acids (1-281 a.a.) and having a molecular mass of 33.2kDa (Molecular weight on SDS-PAGE will appear higher). The EEF1D is purified by proprietary chromatographic techniques.

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0657006 1.0 ug DNA
EUR 167.00

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0657007 1.0 ug DNA
EUR 167.00

EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0657008 1.0 ug DNA
EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4608206 1.0 ug DNA
EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4608207 1.0 ug DNA
EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4608208 1.0 ug DNA
EUR 167.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV679496 1.0 ug DNA
EUR 682.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV679497 1.0 ug DNA
EUR 740.00

EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV679498 1.0 ug DNA
EUR 740.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV709594 1.0 ug DNA
EUR 316.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV709595 1.0 ug DNA
EUR 374.00

EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV709596 1.0 ug DNA
EUR 374.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7151206 1.0 ug DNA
EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7151207 1.0 ug DNA
EUR 167.00

Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7151208 1.0 ug DNA
EUR 167.00

Staining with antibodies to growth-associated protein-43 and microtubule-associated protein-2 revealed segregation of immunoreactivity into separate axonal and somato-dendritic compartments, respectively. In keeping with our physiological proof for synapse formation, intense punctate staining was noticed with antibodies to the synaptic vesicle proteins synapsin, SV2, and synaptophysin. These outcomes exhibit the in vitro acquisition by pluri-potent cell strains of neuronal polarity and useful synaptic transmission that’s attribute of CNS neurons.