The molecular biology of Oct-4 in the early mouse embryo.

Preimplantation improvement within the mouse is characterised by the incidence of a number of important genetic and epigenetic occasions. Till just lately, little or no was recognized in regards to the regulation of those occasions. The seek for genes that are concerned within the management of the earliest phases of mouse improvement has to date resulted in just a few candidates. Oct-4, a member of the POU transcription issue household, is encoded by a gene belonging to this group.

Initially current as a maternal issue within the oocyte, Oct-Four is expressed by the embryo all through the preimplantation interval, in addition to in germ cell precursors of grownup mice. Oct-Four expression is correlated with an undifferentiated phenotype, each within the embryo and in cell traces derived from it.

Regulation of the Oct-Four gene depends on the exercise of two separate enhancers, certainly one of which is particularly energetic in pluri– and totipotent cells. Its operate as a transcriptional regulator is supported by the identification of an growing variety of potential goal genes, together with some recognized to be important for early embryonic improvement.

Early steps in microbial colonization processes at deep-sea hydrothermal vents.

pluri-disciplinary in situ colonization experiment was carried out to review early phases of colonization in deep-sea vent Alvinella spp. worm habitats. 4 colonization units have been deployed onto Alvinella spp. colonies of various chimneys of the East-Pacific Rise (EPR 13 levels N), for 2 completely different intervals: a brief (lower than every week) and an extended one (three weeks).

Video imagery and monitoring of the thermal and physico-chemical situations have been carried out in the course of the colonization experiments. Quite a few microorganisms bearing specialised adhesion-appendages and/or excessive quantities of polymeric extracellular matrix have been noticed on units, which can effectively contribute to the colonization of recent surfaces. The microbial cohorts previous and accompanying Alvinella spp. settlement have been recognized.

EEF2 Antibody

BF0405 200ul
EUR 376.00
Description: EEF2 antibody detects endogenous levels of total EEF2.

eEF2 Antibody

AF7720 200ul
EUR 376.00
Description: eEF2 Antibody detects endogenous levels of eEF2.

eEF2 Antibody

AF7721 200ul
EUR 376.00
Description: eEF2 Antibody detects endogenous levels of eEF2.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF2 antibody

70R-51523 100 ul
EUR 244.00
Description: Purified Polyclonal EEF2 antibody

EEF2 antibody

70R-2318 50 ug
EUR 467.00
Description: Rabbit polyclonal EEF2 antibody raised against the N terminal of EEF2

eEF2 antibody

70R-31022 100 ug
EUR 327.00
Description: Rabbit polyclonal eEF2 antibody

EEF2 Antibody

ABD6798 100 ug
EUR 438.00

EEF2 antibody

10R-10728 100 ug
EUR 381.00
Description: Mouse monoclonal EEF2 antibody

EEF2 antibody

10R-11163 100 ug
EUR 349.00
Description: Mouse Monoclonal EEF2 antibody

EEF2 Antibody

32582-100ul 100ul
EUR 252.00

EEF2 antibody

70R-17005 50 ul
EUR 435.00
Description: Rabbit polyclonal EEF2 antibody

EEF2 Antibody

DF6798 200ul
EUR 304.00
Description: EEF2 Antibody detects endogenous levels of total EEF2.

EEF2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

EEF2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EEF2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100

EEF2 Blocking Peptide

BF0405-BP 1mg
EUR 195.00

EEF2 Conjugated Antibody

C32582 100ul
EUR 397.00

eEF2 Blocking Peptide

AF7720-BP 1mg
EUR 195.00

eEF2 Blocking Peptide

AF7721-BP 1mg
EUR 195.00

EEF2 cloning plasmid

CSB-CL007434HU-10ug 10ug
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2577
  • Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata
  • Show more
Description: A cloning plasmid for the EEF2 gene.

anti- EEF2 antibody

FNab02651 100µg
EUR 585.00
  • Immunogen: eukaryotic translation elongation factor 2
  • Uniprot ID: P13639
  • Gene ID: 1938
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF2

EEF2 (pT56) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

eEF2 Polyclonal Antibody

ABP58457-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody

ABP58457-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

eEF2 Polyclonal Antibody

ABP58457-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein

EEF2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EEF2 Rabbit pAb

A0099-100ul 100 ul
EUR 308.00

EEF2 Rabbit pAb

A0099-200ul 200 ul
EUR 459.00

EEF2 Rabbit pAb

A0099-20ul 20 ul
EUR 183.00

EEF2 Rabbit pAb

A0099-50ul 50 ul
EUR 223.00

EEF2 Polyclonal Antibody

A53432 100 µg
EUR 570.55
Description: reagents widely cited

eEF2 antibody (Thr56)

70R-31021 100 ug
EUR 327.00
Description: Rabbit polyclonal eEF2 antibody (Thr56)

EEF2 Rabbit pAb

A2068-100ul 100 ul
EUR 308.00

EEF2 Rabbit pAb

A2068-200ul 200 ul
EUR 459.00

EEF2 Rabbit pAb

A2068-20ul 20 ul
EUR 183.00

EEF2 Rabbit pAb

A2068-50ul 50 ul
EUR 223.00

EEF2 Blocking Peptide

33R-9020 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318

EEF2 Monoclonal Antibody

27102-100ul 100ul
EUR 252.00

EEF2 Monoclonal Antibody

27102-50ul 50ul
EUR 187.00

EEF2 Blocking Peptide

DF6798-BP 1mg
EUR 195.00

eEF2, Rabbit Reticulocytes

EUR 370.00

Anti-EEF2 antibody

PAab02651 100 ug
EUR 412.00

anti-EEF2 (5B6)

LF-MA30553 100 ul
EUR 527.00
Description: Mouse Monoclonal to EEF2

Anti-eEF2 antibody

STJ99607 200 µl
EUR 197.00
Description: Rabbit polyclonal to eEF2.

Anti-eEF2 antibody

STJ99117 200 µl
EUR 197.00
Description: Mouse monoclonal to eEF2.

Anti-EEF2 antibody

STJ23480 100 µl
EUR 277.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

Anti-EEF2 antibody

STJ114864 100 µl
EUR 277.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

EEF2 Conjugated Monoclonal Antibody

C27102 100ul
EUR 397.00

Rat EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-eEF2 (Tyr443) Antibody

AF7220 200ul
EUR 376.00
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2 only when phosphorylated at Tyr443.

Phospho-eEF2 (Thr57) Antibody

AF7221 200ul
EUR 376.00
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2 only when phosphorylated at Thr57.


EF004938 96 Tests
EUR 689.00

EEF2 (pT56) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Phospho- eEF2 (Thr56) Antibody

ABF3572 100 ug
EUR 438.00

Human EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF2 protein (His tag)

80R-3897 100 ug
EUR 327.00
Description: Purified recombinant EEF2 protein (His tag)

EEF2 recombinant monoclonal antibody

A5481 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA

eEF2 (Phospho-Tyr443) Antibody

13078-100ul 100ul
EUR 252.00

eEF2 (Phospho-Tyr443) Antibody

13078-50ul 50ul
EUR 187.00

eEF2 (Phospho-Thr57) Antibody

13079-100ul 100ul
EUR 252.00

eEF2 (Phospho-Thr57) Antibody

13079-50ul 50ul
EUR 187.00

Mouse EEF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EEF2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-EEF2 (T56) Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Anti-EEF2 Monoclonal Antibody

M00830-1 100ug
EUR 397.00
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

pCMV-HA-EEF2 Plasmid

PVTB00283-2a 2 ug
EUR 356.00

Monoclonal EEF2 Antibody, Clone: 5B6

APR07656G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E

Phospho-EEF2-T56 Rabbit pAb

AP0832-100ul 100 ul
EUR 384.00

Phospho-EEF2-T56 Rabbit pAb

AP0832-200ul 200 ul
EUR 554.00

Phospho-EEF2-T56 Rabbit pAb

AP0832-20ul 20 ul
EUR 183.00

Phospho-EEF2-T56 Rabbit pAb

AP0832-50ul 50 ul
EUR 265.00

eEF2 (Phospho-Tyr443) Conjugated Antibody

C13078 100ul
EUR 397.00

eEF2 (Phospho-Thr57) Conjugated Antibody

C13079 100ul
EUR 397.00

Phospho-eEF2 (Tyr443) Blocking Peptide

AF7220-BP 1mg
EUR 195.00

Phospho-eEF2 (Thr57) Blocking Peptide

AF7221-BP 1mg
EUR 195.00

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

eEF2 (Phospho-Thr56) Polyclonal Antibody

ABP58456-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein

EEF2 Polyclonal Antibody, Biotin Conjugated

A53429 100 µg
EUR 570.55
Description: fast delivery possible

EEF2 Polyclonal Antibody, FITC Conjugated

A53430 100 µg
EUR 570.55
Description: reagents widely cited

EEF2 Polyclonal Antibody, HRP Conjugated

A53431 100 µg
EUR 570.55
Description: Ask the seller for details

Mouse Elongation factor 2 (Eef2)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 97.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast

Human Elongation factor 2 (EEF2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 99.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli

Eef2 ORF Vector (Rat) (pORF)

ORF066367 1.0 ug DNA
EUR 506.00

Eef2 ORF Vector (Mouse) (pORF)

ORF043640 1.0 ug DNA
EUR 506.00

EEF2 ORF Vector (Human) (pORF)

ORF012901 1.0 ug DNA
EUR 95.00

pCDNA3.1- EEF2- Myc- 6*His

PVT10365 2 ug
EUR 337.00

Anti-Phospho-eEF2 (Thr56) antibody

STJ99592 200 µl
EUR 197.00
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56).

Anti-Phospho-EEF2-T56 antibody

STJ11100973 100 µl
EUR 393.00
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation.

EEF2 ELISA Kit (Human) (OKEH04964)

OKEH04964 96 Wells
EUR 779.00
Description: Description of target: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

EEF2 ELISA Kit (Rat) (OKEH05938)

OKEH05938 96 Wells
EUR 779.00
Description: Description of target: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

eEF2 Colorimetric Cell-Based ELISA Kit

EKC1180 100ul
EUR 572.00

EEF2 sgRNA CRISPR Lentivector set (Human)

K0657801 3 x 1.0 ug
EUR 339.00

Anti-EEF2 Antibody (4B3-G7-H5)

EUR 338.00

Eef2 sgRNA CRISPR Lentivector set (Mouse)

K3928501 3 x 1.0 ug
EUR 339.00

Eef2 sgRNA CRISPR Lentivector set (Rat)

K6785201 3 x 1.0 ug
EUR 339.00

Cow Elongation Factor 2 (EEF2) ELISA Kit

abx521279-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Chicken Elongation Factor 2 (EEF2) ELISA Kit

abx521280-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Elongation Factor 2 (EEF2) ELISA Kit

abx521281-96tests 96 tests
EUR 739.00
  • Shipped within 5-12 working days.

Rat Elongation Factor 2 (EEF2) ELISA Kit

abx521283-96tests 96 tests
EUR 739.00
  • Shipped within 5-12 working days.

Mouse Eef2/ Elongation factor 2 ELISA Kit

E0450Mo 1 Kit
EUR 632.00

Rat Eef2/ Elongation factor 2 ELISA Kit

E0319Ra 1 Kit
EUR 646.00

Human EEF2/ Elongation factor 2 ELISA Kit

E0763Hu 1 Kit
EUR 605.00

Rabbit Elongation factor 2, EEF2 ELISA KIT

ELI-26044Ra 96 Tests
EUR 928.00

Bovine Elongation factor 2, EEF2 ELISA KIT

ELI-26079b 96 Tests
EUR 928.00

Chicken Elongation factor 2, EEF2 ELISA KIT

ELI-09302c 96 Tests
EUR 928.00

Human Elongation factor 2, EEF2 ELISA KIT

ELI-09303h 96 Tests
EUR 824.00

Rat Elongation factor 2, Eef2 ELISA KIT

ELI-32279r 96 Tests
EUR 886.00

Mouse Elongation factor 2, Eef2 ELISA KIT

ELI-32416m 96 Tests
EUR 865.00

Mouse Eef2(Elongation factor 2) ELISA Kit

EM0821 96T
EUR 567.60
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58252
  • Alias: Eef2/EF-2/EF2EEF-2/elongation factor 2/eukaryotic translation elongation factor 2/polypeptidyl-tRNA translocase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

EEF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0657802 1.0 ug DNA
EUR 154.00

EEF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0657803 1.0 ug DNA
EUR 154.00

EEF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0657804 1.0 ug DNA
EUR 154.00

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx159481-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx012012-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mouse Elongation Factor 2 (EEF2) ELISA Kit

abx255169-96tests 96 tests
EUR 739.00
  • Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody

abx232651-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Human elongation factor 2(eEF2) ELISA Kit

CSB-E13572h-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2 (eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human elongation factor 2(eEF2) ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2(eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3928502 1.0 ug DNA
EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3928503 1.0 ug DNA
EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3928504 1.0 ug DNA
EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6785202 1.0 ug DNA
EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6785203 1.0 ug DNA
EUR 154.00

Eef2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6785204 1.0 ug DNA
EUR 154.00

EEF2 Protein Vector (Human) (pPB-C-His)

PV051601 500 ng
EUR 481.00

EEF2 Protein Vector (Human) (pPB-N-His)

PV051602 500 ng
EUR 481.00

EEF2 Protein Vector (Human) (pPM-C-HA)

PV051603 500 ng
EUR 481.00

EEF2 Protein Vector (Human) (pPM-C-His)

PV051604 500 ng
EUR 481.00

Recombinant Eukaryotic Translation Elongation Factor 2 (EEF2)

  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P13639
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 2 expressed in: E.coli

EEF2 Protein Vector (Mouse) (pPB-C-His)

PV174558 500 ng
EUR 1065.00

EEF2 Protein Vector (Mouse) (pPB-N-His)

PV174559 500 ng
EUR 1065.00

EEF2 Protein Vector (Mouse) (pPM-C-HA)

PV174560 500 ng
EUR 1065.00

EEF2 Protein Vector (Mouse) (pPM-C-His)

PV174561 500 ng
EUR 1065.00

EEF2 Protein Vector (Rat) (pPB-C-His)

PV265466 500 ng
EUR 1166.00

EEF2 Protein Vector (Rat) (pPB-N-His)

PV265467 500 ng
EUR 1166.00

EEF2 Protein Vector (Rat) (pPM-C-HA)

PV265468 500 ng
EUR 1166.00

EEF2 Protein Vector (Rat) (pPM-C-His)

PV265469 500 ng
EUR 1166.00

Eef2 3'UTR Luciferase Stable Cell Line

TU203793 1.0 ml Ask for price

Eef2 3'UTR GFP Stable Cell Line

TU155615 1.0 ml Ask for price

EEF2 3'UTR Luciferase Stable Cell Line

TU006629 1.0 ml
EUR 1394.00

Eef2 3'UTR Luciferase Stable Cell Line

TU105615 1.0 ml Ask for price

EEF2 3'UTR GFP Stable Cell Line

TU056629 1.0 ml
EUR 1394.00

Eef2 3'UTR GFP Stable Cell Line

TU253793 1.0 ml Ask for price

eEF2 Colorimetric Cell-Based ELISA Kit (OKAG00679)

OKAG00679 96 Wells
EUR 596.00
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

EEF2 ELISA Kit (Mouse) : 96 Wells (OKEH01997)

OKEH01997 96 Wells
EUR 779.00
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

Eukaryotic Translation Elongation Factor 2 (EEF2) ELISA Kit

abx595189-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

eEF2 (Phospho-Thr56) Colorimetric Cell-Based ELISA Kit

EKC1985 100ul
EUR 572.00

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Human Eukaryotic Translation Elongation Factor 2 (EEF2) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

EEF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671713 1.0 ug DNA
EUR 1355.00

EEF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671717 1.0 ug DNA
EUR 1355.00

EEF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671718 1.0 ug DNA
EUR 1355.00

Eef2 ELISA Kit| Rat Elongation factor 2 ELISA Kit

EF018655 96 Tests
EUR 689.00

EEF2 ELISA Kit| Bovine Elongation factor 2 ELISA Kit

EF011366 96 Tests
EUR 689.00

EEF2 ELISA Kit| chicken Elongation factor 2 ELISA Kit

EF012297 96 Tests
EUR 689.00

Eef2 ELISA Kit| Mouse Elongation factor 2 ELISA Kit

EF013430 96 Tests
EUR 689.00

EEF2 Eukaryotic Translation Elongation Factor 2 Human Recombinant Protein

PROTP13639 Regular: 20ug
EUR 317.00
Description: EEF2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 308 amino acids (574-858) and having a molecular mass of 34.3kDa.;EEF2 is fused to a 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2)

Phospho-eEF2 (Thr56) Colorimetric Cell-Based ELISA Kit (OKAG01510)

OKAG01510 2 x 96 Wells
EUR 740.00
Description: Description of target: ;Species reactivity: Human: T56, Mouse: T56, Rat: T56;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

EEF2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0657805 3 x 1.0 ug
EUR 376.00

Eukaryotic Translation Elongation Factor 2 Phospho-Thr56 (EEF2 pT56) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eef2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3928505 3 x 1.0 ug
EUR 376.00

Eef2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6785205 3 x 1.0 ug
EUR 376.00

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with APC.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Biotin.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Cy3.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with FITC.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with HRP.

Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: EEF2 (Lys32~Val233)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with PE.

EEF2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0657806 1.0 ug DNA
EUR 167.00

In all instances, Archaea couldn’t be detected and the microbial mats have been basically composed of e-Proteobacteria. Inside this group, one phylotype (AlviH2) was discovered to dominate the libraries of three colonization units. Dominance of e-Proteobacteria within the libraries might replicate the vast physiological selection encountered inside this group or an adaptability of those microorganisms in the direction of their altering surroundings. Micro organism affiliated to the Cytophaga-Flavobacterium-Bacteroides group or to the e-Proteobacteria, that develop both chemo-organoheterotrophically by fermentation or chemolithoautotrophically with H2 as an electron donor and S levels /S2O32- or NO3- as a terminal electron acceptor, have been remoted from one of many microbial mat fashioned in 20 days.