The event of cell tradition programs for the naturalistic propagation, self-renewal and differentiation of cells ex vivo is a excessive purpose of molecular engineering. Regardless of vital success in recent times, the excessive value of up-scaling cultures, the necessity for xeno-free tradition situations, and the diploma of mimicry of the natural extracellular matrix attainable in vitro utilizing designer substrates proceed to pose obstacles to the interpretation of cell-based technologies.
On this regard, the ZT biopolymer is a protein-based, steady, scalable, and economical cell substrate of excessive promise. ZT relies on the naturally occurring meeting of two human proteins: titin-Z1Z2 and telethonin. These protein constructing blocks are strong scaffolds that may be conveniently functionalized with full-length proteins and bioactive peptidic motifs by genetic manipulation, previous to self-assembly.
The polymer is, thereby, totally encodable. Functionalized variations of the ZT polymer have been proven to efficiently maintain the long-term culturing of human embryonic stem cells (hESCs), human induced pluripotent stem cells (hiPSCs), and murine mesenchymal stromal cells (mMSCs).
Pluripotency of hESCs and hiPSCs was retained for the longest interval assayed (four months). Outcomes level to the big potential of the ZT system for the creation of a modular, pluri-functional biomaterial for cell-based purposes.
Maxwell®: An Unsupervised Studying Method for 5P Medication.
Within the 5P medication (Customized, Preventive, Participative, Predictive and Pluri-expert), the final pattern is to course of information by displacing the barycenter of the data from hospital centered programs to the affected person centered ones by his private medical information.
 ELISA Kit, 96 tests, quantitative) Mouse Epidermal Growth Factor (EGF) ELISA Kit, 96 tests, quantitative |
|
210-150-EGF |
Alpha Diagnostics |
1 Kit |
EUR 773 |
 ELISA Kit) Human Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Hu-48T |
DL Develop |
48T |
EUR 317 |
- Should the Human Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Hu-96T |
DL Develop |
96T |
EUR 398 |
- Should the Human Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
 ELISA Kit) Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Mu-48T |
DL Develop |
48T |
EUR 315 |
- Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Mu-96T |
DL Develop |
96T |
EUR 396 |
- Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
 ELISA Kit) Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-p-48T |
DL Develop |
48T |
EUR 493 |
- Should the Porcine Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-p-96T |
DL Develop |
96T |
EUR 641 |
- Should the Porcine Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
 ELISA Kit) Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Ra-48T |
DL Develop |
48T |
EUR 372 |
- Should the Rat Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
DLR-EGF-Ra-96T |
DL Develop |
96T |
EUR 475 |
- Should the Rat Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 307 |
Human Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 418 |
Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 305 |
Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 415 |
Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 516 |
Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 716 |
Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 374 |
Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
RDR-EGF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 512 |
Human Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 295 |
Human Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 400 |
Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 293 |
Mouse Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 398 |
Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-p-48Tests |
Reddot Biotech |
48 Tests |
EUR 494 |
Porcine Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-p-96Tests |
Reddot Biotech |
96 Tests |
EUR 684 |
Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 358 |
Rat Epidermal Growth Factor (EGF) ELISA Kit |
|
RD-EGF-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 490 |
 EGF |
|
LF-PR003 |
Abfrontier |
200 ug |
EUR 142 |
|
Description: EGF protein |
 EGF Antibody |
|
AF5148 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EGF Antibody detects endogenous levels of total EGF. |
 EGF siRNA |
|
20-abx901657 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGF Antibody |
|
BF0066 |
Affbiotech |
200ul |
EUR 376 |
|
Description: EGF antibody detects endogenous levels of total EGF. |
 His-EGF |
|
E13-006-1 |
EnoGene |
10μg |
EUR 83 |
His-EGF |
|
E13-006-2 |
EnoGene |
50μg |
EUR 115 |
 EGF Protein |
|
abx069820-1mg |
Abbexa |
1 mg |
EUR 1080 |
- Shipped within 5-10 working days.
|
EGF Protein |
|
abx169012-1mg |
Abbexa |
1 mg |
EUR 453 |
- Shipped within 5-10 working days.
|
EGF siRNA |
|
20-abx915073 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGF siRNA |
|
20-abx915074 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 EGF antibody |
|
70R-5697 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal EGF antibody |
EGF antibody |
|
70R-EG001 |
Fitzgerald |
50 ug |
EUR 273 |
|
Description: Affinity purified Goat polyclonal EGF antibody |
EGF antibody |
|
70R-ER012 |
Fitzgerald |
50 ug |
EUR 273 |
|
Description: Affinity purified Rabbit polyclonal EGF antibody |
EGF Antibody |
|
35720-100ul |
SAB |
100ul |
EUR 252 |
EGF antibody |
|
38447-100ul |
SAB |
100ul |
EUR 252 |
EGF Antibody |
|
49545-100ul |
SAB |
100ul |
EUR 333 |
EGF Antibody |
|
49545-50ul |
SAB |
50ul |
EUR 239 |
EGF antibody |
|
10-E39A |
Fitzgerald |
500 ug |
EUR 566 |
|
Description: Mouse monoclonal EGF antibody |
EGF antibody |
|
10R-7766 |
Fitzgerald |
500 ug |
EUR 565 |
|
Description: Mouse monoclonal EGF antibody |
 EGF protein |
|
30R-1056 |
Fitzgerald |
100 ug |
EUR 268 |
|
Description: Purified recombinant Human EGF protein |
EGF protein |
|
30R-2331 |
Fitzgerald |
500 ug |
EUR 317 |
|
Description: Purified recombinant Human EGF protein |
EGF protein |
|
30R-2332 |
Fitzgerald |
500 ug |
EUR 325 |
|
Description: Purified recombinant Mouse EGF protein |
EGF protein |
|
30R-2333 |
Fitzgerald |
20 ug |
EUR 210 |
|
Description: Purified recombinant Rat EGF protein |
EGF protein |
|
30R-AE003 |
Fitzgerald |
1 mg |
EUR 381 |
|
Description: Purified recombinant Human EGF protein |
EGF protein |
|
30R-AE004 |
Fitzgerald |
100 ug |
EUR 133 |
|
Description: Purified recombinant Human EGF protein |
EGF protein |
|
30R-AE025 |
Fitzgerald |
100 ug |
EUR 273 |
|
Description: Purified recombinant Human EGF protein |
EGF antibody |
|
10R-2038 |
Fitzgerald |
100 ul |
EUR 403 |
|
Description: Mouse monoclonal EGF antibody |
EGF antibody |
|
10R-2176 |
Fitzgerald |
100 ul |
EUR 403 |
|
Description: Mouse monoclonal EGF antibody |
EGF antibody |
|
10R-2969 |
Fitzgerald |
100 ug |
EUR 265 |
|
Description: Mouse monoclonal EGF antibody |
EGF antibody |
|
10R-2985 |
Fitzgerald |
100 ug |
EUR 265 |
|
Description: Mouse monoclonal EGF antibody |
EGF antibody |
|
20C-CR1085GP |
Fitzgerald |
100 ug |
EUR 148 |
|
Description: Goat polyclonal EGF antibody |
EGF antibody |
|
20R-1772 |
Fitzgerald |
100 ug |
EUR 673 |
|
Description: Rabbit polyclonal EGF antibody |
EGF antibody |
|
70R-12248 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal EGF antibody |
EGF antibody |
|
70R-12249 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal EGF antibody |
EGF antibody |
|
70R-13940 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Affinity purified Goat polyclonal EGF antibody |
EGF antibody |
|
70-ER40 |
Fitzgerald |
50 ug |
EUR 284 |
|
Description: Affinity purified Rabbit polyclonal EGF antibody |
EGF antibody |
|
70R-15294 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Rabbit polyclonal EGF antibody |
EGF Antibody |
|
DF7063 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EGF Antibody detects endogenous levels of total EGF. |
EGF Antibody |
|
1-CSB-PA942209 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EGF. Recognizes EGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
EGF Antibody |
|
DF2225 |
Affbiotech |
200ul |
EUR 304 |
|
Description: EGF antibody detects endogenous levels of total EGF. |
EGF Antibody |
|
1-CSB-PA007939 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against EGF. Recognizes EGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000 |
EGF Antibody |
|
1-CSB-PA846755 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EGF. Recognizes EGF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
 egf Antibody |
|
1-CSB-PA24449A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against egf. Recognizes egf from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
EGF Antibody |
|
1-CSB-PA06244A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against EGF. Recognizes EGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
 EGF Mouse |
|
P2558-.1 |
ApexBio |
100 µg |
EUR 108 |
EGF Mouse |
|
P2558-.5 |
ApexBio |
500 µg |
EUR 200 |
EGF Mouse |
|
P2558-1 |
ApexBio |
1 mg |
EUR 311 |
 anti-EGF |
|
YF-PA23628 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to EGF |
 Polyclonal EGF Antibody |
|
APR00243G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGF . This antibody is tested and proven to work in the following applications: |
Polyclonal EGF Antibody |
|
APR00244G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EGF . This antibody is tested and proven to work in the following applications: |
 EGF Blocking Peptide |
|
AF5148-BP |
Affbiotech |
1mg |
EUR 195 |
 EGF Conjugated Antibody |
|
C38447 |
SAB |
100ul |
EUR 397 |
EGF Conjugated Antibody |
|
C49545 |
SAB |
100ul |
EUR 397 |
EGF Blocking Peptide |
|
BF0066-BP |
Affbiotech |
1mg |
EUR 195 |
EGF Conjugated Antibody |
|
C35720 |
SAB |
100ul |
EUR 397 |
 EGF cloning plasmid |
|
CSB-CL007473HU-10ug |
Cusabio |
10ug |
EUR 1280 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3624
- Sequence: ATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCCTGAAGGTACTCTCGCAGGAAATGGGAATTCTACTTGTGTGGGTCCTGCACCCTTCTTAATTTTCTCCCATGGAAATAGTATCTTTAGGA
- Show more
|
|
Description: A cloning plasmid for the EGF gene. |
) rec EGF (human) |
|
H-7490.0100 |
Bachem |
0.1mg |
EUR 162 |
|
Description: Sum Formula: C270H395N73O83S7; CAS# [62253-63-8] |
rec EGF (human) |
|
H-7490.0500 |
Bachem |
0.5mg |
EUR 381 |
|
Description: Sum Formula: C270H395N73O83S7; CAS# [62253-63-8] |
 EGF Polyclonal Antibody |
|
ES5049-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against EGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
EGF Polyclonal Antibody |
|
ES5049-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against EGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
EGF Polyclonal Antibody |
|
ES8651-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against EGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
EGF Polyclonal Antibody |
|
ES8651-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against EGF from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
EGF Polyclonal Antibody |
|
ABP58462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060 |
EGF Polyclonal Antibody |
|
ABP58462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060 |
EGF Polyclonal Antibody |
|
ABP58462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGF protein at amino acid sequence of 1000-1060 |
) EGF Protein (OVA) |
|
20-abx165531 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Human EGF Protein |
|
20-abx060144 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGF Polyclonal Antibody |
|
ABP54050-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human EGF
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF |
EGF Polyclonal Antibody |
|
ABP54050-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human EGF
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF |
EGF Polyclonal Antibody |
|
ABP54050-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human EGF
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EGF from Human, Mouse, Rat. This EGF antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EGF |
 Pro-EGF Antibody |
|
abx433183-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Anti-EGF Antibody |
|
A00378 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal Antibody for EGF Antibody (EGF) detection.tested for WB in Human, Mouse, Rat. |
Anti-EGF Antibody |
|
A00378-1 |
BosterBio |
100ug/vial |
EUR 334 |
 EGF Rabbit pAb |
|
A12916-100ul |
Abclonal |
100 ul |
EUR 308 |
In the present day, using synthetic intelligence for supporting this transition exhibits actual limitations in its implementation in operational follow, each on the stage of affected person care, but in addition within the basic each day lifetime of the well being skilled, due to the medico-legal imperatives induced by the guarantees of the ‘5P medication’.
On this paper, we suggest to fill this hole by introducing an authentic synthetic intelligence platform, named Maxwell, which follows an unsupervised studying method consistent with the medico-legal imperatives of the ‘5P medication’. We describe the useful platform traits and illustrate them by two examples of clustering in genomics and magnetic resonance imaging.
)
